Incidental Mutation 'R6860:B4galt1'
ID535418
Institutional Source Beutler Lab
Gene Symbol B4galt1
Ensembl Gene ENSMUSG00000028413
Gene NameUDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1
SynonymsGalT, Ggtb, beta 1,4-Galactosyltransferase I, Ggtb2, beta-1,4-GalT1, b1,4-Galactosyltransferase I, B-1,4-GalT1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6860 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location40804602-40854005 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 40807796 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 335 (V335E)
Ref Sequence ENSEMBL: ENSMUSP00000030121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030121] [ENSMUST00000108096]
Predicted Effect probably benign
Transcript: ENSMUST00000030121
AA Change: V335E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000030121
Gene: ENSMUSG00000028413
AA Change: V335E

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
low complexity region 73 89 N/A INTRINSIC
Pfam:Glyco_transf_7N 131 264 3.1e-62 PFAM
Pfam:Glyco_transf_7C 268 346 5.9e-32 PFAM
Pfam:Glyco_tranf_2_2 279 339 4.1e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108096
SMART Domains Protein: ENSMUSP00000103731
Gene: ENSMUSG00000028413

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
low complexity region 73 89 N/A INTRINSIC
Pfam:Glyco_transf_7N 131 266 1.8e-52 PFAM
Pfam:Glyco_transf_7C 268 328 8.7e-26 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 100% (86/86)
MGI Phenotype FUNCTION: This gene encodes two distinct enzyme isoforms, a long membrane-bound form and a short soluble form. These alternate isoforms are thought to be produced through alternative nested transcription initiation and different in-frame start codon usage. These enzymes catalyze the transfer of galactose to acceptor sugars, such as N-acetylglucosamine and glucose. The long form of this enzyme is localized to the trans-Golgi membrane and is involved in glycoconjugate biosynthesis. The short form functions in lactose biosynthesis though formation of a heterodimer with alpha-lactalbumin. [provided by RefSeq, Nov 2012]
PHENOTYPE: Homozygotes for targeted null mutations exhibit growth retardation, low viability, excessive epithelial cell proliferation of skin and small intestine, sperm with reduced fertilizing capacity, birthing difficulty, and mammary gland defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A G 11: 23,625,100 L58P probably damaging Het
4933427D14Rik T C 11: 72,189,586 E418G probably damaging Het
9930012K11Rik C A 14: 70,157,622 V28L possibly damaging Het
Abtb2 C T 2: 103,709,425 R712* probably null Het
Acvr1c C T 2: 58,287,705 G171S probably damaging Het
Ahctf1 G T 1: 179,753,288 A1783E probably benign Het
Anapc4 A T 5: 52,848,828 Q149L probably damaging Het
Ankrd27 T C 7: 35,628,527 V824A possibly damaging Het
Ankrd31 G C 13: 96,831,586 C577S probably benign Het
Apol7c T C 15: 77,526,074 N224S probably benign Het
Arl14 A T 3: 69,222,696 T59S probably benign Het
Astn1 T A 1: 158,612,472 I870K probably damaging Het
C2cd3 C T 7: 100,390,241 P216S probably benign Het
Cchcr1 C A 17: 35,529,118 N711K possibly damaging Het
Chd2 A G 7: 73,497,810 F467L possibly damaging Het
Cntn6 A T 6: 104,861,946 E987V possibly damaging Het
Col11a2 T A 17: 34,053,598 L286H probably damaging Het
Cwc22 C T 2: 77,929,448 R85Q possibly damaging Het
Cyp7a1 A C 4: 6,272,587 F209V probably damaging Het
Dmtn T C 14: 70,614,882 T189A possibly damaging Het
Dnhd1 C G 7: 105,678,266 N777K probably benign Het
Dusp16 A T 6: 134,725,879 C216* probably null Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fbn1 T C 2: 125,328,158 N1993S probably damaging Het
Fbxw22 A G 9: 109,383,962 S306P probably benign Het
Ferd3l T C 12: 33,928,652 S55P probably benign Het
Fpr-rs3 A G 17: 20,624,298 S194P possibly damaging Het
Gm19965 G A 1: 116,820,879 D97N probably benign Het
Gtpbp2 A G 17: 46,167,988 probably benign Het
Hcn3 A C 3: 89,159,845 I72S possibly damaging Het
Hist1h3f G T 13: 23,544,590 V36L probably benign Het
Hk3 T A 13: 55,014,465 N109Y probably damaging Het
Iqub T C 6: 24,505,738 E57G possibly damaging Het
Kcnk3 T A 5: 30,622,053 M149K possibly damaging Het
Kcp C T 6: 29,505,720 G51D probably benign Het
Kif26a C A 12: 112,146,829 A53D probably damaging Het
Lifr T A 15: 7,172,937 I353K probably benign Het
Llph A T 10: 120,231,284 N102I probably damaging Het
Lmo3 C A 6: 138,416,568 R18L possibly damaging Het
Lrrc46 T C 11: 97,035,545 E175G probably benign Het
Ltk A T 2: 119,754,594 C128* probably null Het
Map1b T C 13: 99,434,767 E482G probably damaging Het
Mapk8ip2 T C 15: 89,460,452 V740A probably damaging Het
Miga2 T C 2: 30,371,163 W157R probably benign Het
Mlip A G 9: 77,102,393 *837Q probably null Het
Mroh2a G T 1: 88,254,935 R1195L possibly damaging Het
Myl1 T C 1: 66,945,058 probably benign Het
Olfr365 T C 2: 37,202,177 L312P possibly damaging Het
Olfr448 T C 6: 42,896,816 Y122H probably benign Het
Olfr613 A G 7: 103,551,868 I28V probably benign Het
P3h3 A T 6: 124,857,368 V107D probably benign Het
Papolb A T 5: 142,528,896 S331T possibly damaging Het
Pars2 T G 4: 106,654,503 V494G probably benign Het
Pcdhb3 C A 18: 37,301,710 T243K probably benign Het
Pde9a T A 17: 31,470,724 M415K probably damaging Het
Ppp1r9b G A 11: 94,992,148 A201T probably benign Het
Prl A G 13: 27,064,959 N197S possibly damaging Het
Prl2c1 T A 13: 27,851,741 M32K probably benign Het
Prrt4 T C 6: 29,170,738 S572G possibly damaging Het
Psd T A 19: 46,322,419 D397V probably damaging Het
Psme2b A T 11: 48,945,480 Y213* probably null Het
Ptcd3 T A 6: 71,897,110 probably null Het
Ptprk T G 10: 28,334,484 F167L probably damaging Het
Rfx7 T C 9: 72,616,944 V472A probably damaging Het
Scnn1g T C 7: 121,740,353 L125S probably damaging Het
Sec16a T C 2: 26,430,112 Y1438C probably damaging Het
Serinc3 C T 2: 163,634,446 S155N probably benign Het
Slc3a2 A T 19: 8,713,632 V78E probably damaging Het
Slc44a4 T A 17: 34,921,068 L23Q probably damaging Het
Slco5a1 C T 1: 12,881,196 probably benign Het
Slit1 A G 19: 41,616,715 M899T probably benign Het
Sorl1 A G 9: 42,022,392 I1094T probably benign Het
Spag9 T A 11: 94,081,370 L258Q probably benign Het
Strip1 T C 3: 107,618,936 E488G possibly damaging Het
Stx18 G A 5: 38,104,891 D30N possibly damaging Het
Sync T C 4: 129,287,790 probably null Het
Syncrip A G 9: 88,476,796 V220A probably damaging Het
Tagln2 T C 1: 172,505,909 I110T probably benign Het
Taok1 T C 11: 77,541,801 T729A probably benign Het
Tgfbrap1 C T 1: 43,067,599 V75I possibly damaging Het
Tnfrsf21 A G 17: 43,017,066 T24A probably benign Het
Tnxb T A 17: 34,713,157 D2221E probably damaging Het
Triml1 A G 8: 43,130,566 S333P probably damaging Het
Trp53bp1 C A 2: 121,199,113 R1862L probably damaging Het
Tsc22d1 T G 14: 76,418,292 I737S possibly damaging Het
U2af2 A T 7: 5,079,274 K462N possibly damaging Het
Ubap2 A C 4: 41,233,631 N86K probably damaging Het
Uso1 A G 5: 92,195,348 K764E probably benign Het
Vmn1r192 T A 13: 22,187,952 M33L probably benign Het
Other mutations in B4galt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01795:B4galt1 APN 4 40807760 missense probably damaging 1.00
periwinkle UTSW 4 40807760 missense probably damaging 1.00
R1589:B4galt1 UTSW 4 40823575 missense probably benign 0.28
R3797:B4galt1 UTSW 4 40807258 missense probably benign 0.12
R4419:B4galt1 UTSW 4 40853537 missense probably benign
R4703:B4galt1 UTSW 4 40823569 missense probably benign 0.14
R4727:B4galt1 UTSW 4 40807812 missense probably damaging 1.00
R5706:B4galt1 UTSW 4 40807268 missense probably damaging 0.97
R5903:B4galt1 UTSW 4 40807760 missense probably damaging 1.00
R6878:B4galt1 UTSW 4 40809694 missense probably damaging 1.00
R6943:B4galt1 UTSW 4 40812860 missense probably benign 0.00
R7239:B4galt1 UTSW 4 40812754 missense probably damaging 1.00
R7479:B4galt1 UTSW 4 40823587 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTACAGCCTGTTCCCTTTAAAGG -3'
(R):5'- AGACTTTCTGGGCCATGTTCC -3'

Sequencing Primer
(F):5'- GATAACCGTTCTGACTTCCAAGGG -3'
(R):5'- CCATGTTCCGGCATGATGG -3'
Posted On2018-09-12