Incidental Mutation 'R6860:P3h3'
ID535433
Institutional Source Beutler Lab
Gene Symbol P3h3
Ensembl Gene ENSMUSG00000023191
Gene Nameprolyl 3-hydroxylase 3
SynonymsGrcb, Leprel2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6860 (G1)
Quality Score89.0077
Status Not validated
Chromosome6
Chromosomal Location124841089-124857752 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 124857368 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 107 (V107D)
Ref Sequence ENSEMBL: ENSMUSP00000116338 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023958] [ENSMUST00000046893] [ENSMUST00000135127] [ENSMUST00000204667]
Predicted Effect probably benign
Transcript: ENSMUST00000023958
AA Change: V107D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000023958
Gene: ENSMUSG00000023191
AA Change: V107D

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 58 76 N/A INTRINSIC
low complexity region 127 142 N/A INTRINSIC
low complexity region 222 242 N/A INTRINSIC
low complexity region 256 277 N/A INTRINSIC
P4Hc 460 670 8.51e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000046893
SMART Domains Protein: ENSMUSP00000038536
Gene: ENSMUSG00000038390

DomainStartEndE-ValueType
Pfam:7tm_1 30 337 1.1e-19 PFAM
low complexity region 348 362 N/A INTRINSIC
low complexity region 462 477 N/A INTRINSIC
low complexity region 482 504 N/A INTRINSIC
low complexity region 513 540 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135127
AA Change: V107D

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000116338
Gene: ENSMUSG00000023191
AA Change: V107D

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 58 76 N/A INTRINSIC
low complexity region 127 142 N/A INTRINSIC
low complexity region 222 242 N/A INTRINSIC
low complexity region 256 277 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204667
SMART Domains Protein: ENSMUSP00000145267
Gene: ENSMUSG00000038390

DomainStartEndE-ValueType
Pfam:7tm_1 30 337 1.1e-19 PFAM
low complexity region 348 362 N/A INTRINSIC
low complexity region 462 477 N/A INTRINSIC
low complexity region 482 504 N/A INTRINSIC
low complexity region 513 540 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 100% (86/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the leprecan family of proteoglycans, which function as collagen prolyl hydroxylases that are required for proper collagen biosynthesis, folding and assembly. This protein, like other family members, is thought to reside in the endoplasmic reticulum. Epigenetic inactivation of this gene is associated with breast and other cancers, suggesting that it may function as a tumor suppressor. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit collagen fiber fragility in the skin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A G 11: 23,625,100 L58P probably damaging Het
4933427D14Rik T C 11: 72,189,586 E418G probably damaging Het
9930012K11Rik C A 14: 70,157,622 V28L possibly damaging Het
Abtb2 C T 2: 103,709,425 R712* probably null Het
Acvr1c C T 2: 58,287,705 G171S probably damaging Het
Ahctf1 G T 1: 179,753,288 A1783E probably benign Het
Anapc4 A T 5: 52,848,828 Q149L probably damaging Het
Ankrd27 T C 7: 35,628,527 V824A possibly damaging Het
Ankrd31 G C 13: 96,831,586 C577S probably benign Het
Apol7c T C 15: 77,526,074 N224S probably benign Het
Arl14 A T 3: 69,222,696 T59S probably benign Het
Astn1 T A 1: 158,612,472 I870K probably damaging Het
B4galt1 A T 4: 40,807,796 V335E probably benign Het
C2cd3 C T 7: 100,390,241 P216S probably benign Het
Cchcr1 C A 17: 35,529,118 N711K possibly damaging Het
Chd2 A G 7: 73,497,810 F467L possibly damaging Het
Cntn6 A T 6: 104,861,946 E987V possibly damaging Het
Col11a2 T A 17: 34,053,598 L286H probably damaging Het
Cwc22 C T 2: 77,929,448 R85Q possibly damaging Het
Cyp7a1 A C 4: 6,272,587 F209V probably damaging Het
Dmtn T C 14: 70,614,882 T189A possibly damaging Het
Dnhd1 C G 7: 105,678,266 N777K probably benign Het
Dusp16 A T 6: 134,725,879 C216* probably null Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fbn1 T C 2: 125,328,158 N1993S probably damaging Het
Fbxw22 A G 9: 109,383,962 S306P probably benign Het
Ferd3l T C 12: 33,928,652 S55P probably benign Het
Fpr-rs3 A G 17: 20,624,298 S194P possibly damaging Het
Gm19965 G A 1: 116,820,879 D97N probably benign Het
Gtpbp2 A G 17: 46,167,988 probably benign Het
Hcn3 A C 3: 89,159,845 I72S possibly damaging Het
Hist1h3f G T 13: 23,544,590 V36L probably benign Het
Hk3 T A 13: 55,014,465 N109Y probably damaging Het
Iqub T C 6: 24,505,738 E57G possibly damaging Het
Kcnk3 T A 5: 30,622,053 M149K possibly damaging Het
Kcp C T 6: 29,505,720 G51D probably benign Het
Kif26a C A 12: 112,146,829 A53D probably damaging Het
Lifr T A 15: 7,172,937 I353K probably benign Het
Llph A T 10: 120,231,284 N102I probably damaging Het
Lmo3 C A 6: 138,416,568 R18L possibly damaging Het
Lrrc46 T C 11: 97,035,545 E175G probably benign Het
Ltk A T 2: 119,754,594 C128* probably null Het
Map1b T C 13: 99,434,767 E482G probably damaging Het
Mapk8ip2 T C 15: 89,460,452 V740A probably damaging Het
Miga2 T C 2: 30,371,163 W157R probably benign Het
Mlip A G 9: 77,102,393 *837Q probably null Het
Mroh2a G T 1: 88,254,935 R1195L possibly damaging Het
Myl1 T C 1: 66,945,058 probably benign Het
Olfr365 T C 2: 37,202,177 L312P possibly damaging Het
Olfr448 T C 6: 42,896,816 Y122H probably benign Het
Olfr613 A G 7: 103,551,868 I28V probably benign Het
Papolb A T 5: 142,528,896 S331T possibly damaging Het
Pars2 T G 4: 106,654,503 V494G probably benign Het
Pcdhb3 C A 18: 37,301,710 T243K probably benign Het
Pde9a T A 17: 31,470,724 M415K probably damaging Het
Ppp1r9b G A 11: 94,992,148 A201T probably benign Het
Prl A G 13: 27,064,959 N197S possibly damaging Het
Prl2c1 T A 13: 27,851,741 M32K probably benign Het
Prrt4 T C 6: 29,170,738 S572G possibly damaging Het
Psd T A 19: 46,322,419 D397V probably damaging Het
Psme2b A T 11: 48,945,480 Y213* probably null Het
Ptcd3 T A 6: 71,897,110 probably null Het
Ptprk T G 10: 28,334,484 F167L probably damaging Het
Rfx7 T C 9: 72,616,944 V472A probably damaging Het
Scnn1g T C 7: 121,740,353 L125S probably damaging Het
Sec16a T C 2: 26,430,112 Y1438C probably damaging Het
Serinc3 C T 2: 163,634,446 S155N probably benign Het
Slc3a2 A T 19: 8,713,632 V78E probably damaging Het
Slc44a4 T A 17: 34,921,068 L23Q probably damaging Het
Slco5a1 C T 1: 12,881,196 probably benign Het
Slit1 A G 19: 41,616,715 M899T probably benign Het
Sorl1 A G 9: 42,022,392 I1094T probably benign Het
Spag9 T A 11: 94,081,370 L258Q probably benign Het
Strip1 T C 3: 107,618,936 E488G possibly damaging Het
Stx18 G A 5: 38,104,891 D30N possibly damaging Het
Sync T C 4: 129,287,790 probably null Het
Syncrip A G 9: 88,476,796 V220A probably damaging Het
Tagln2 T C 1: 172,505,909 I110T probably benign Het
Taok1 T C 11: 77,541,801 T729A probably benign Het
Tgfbrap1 C T 1: 43,067,599 V75I possibly damaging Het
Tnfrsf21 A G 17: 43,017,066 T24A probably benign Het
Tnxb T A 17: 34,713,157 D2221E probably damaging Het
Triml1 A G 8: 43,130,566 S333P probably damaging Het
Trp53bp1 C A 2: 121,199,113 R1862L probably damaging Het
Tsc22d1 T G 14: 76,418,292 I737S possibly damaging Het
U2af2 A T 7: 5,079,274 K462N possibly damaging Het
Ubap2 A C 4: 41,233,631 N86K probably damaging Het
Uso1 A G 5: 92,195,348 K764E probably benign Het
Vmn1r192 T A 13: 22,187,952 M33L probably benign Het
Other mutations in P3h3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00985:P3h3 APN 6 124845589 missense probably benign 0.26
IGL02158:P3h3 APN 6 124853092 missense probably damaging 1.00
IGL02654:P3h3 APN 6 124845265 missense possibly damaging 0.95
P0040:P3h3 UTSW 6 124853136 missense probably damaging 0.99
R0024:P3h3 UTSW 6 124857458 missense probably benign
R0196:P3h3 UTSW 6 124845272 missense probably damaging 1.00
R0328:P3h3 UTSW 6 124854306 unclassified probably benign
R0589:P3h3 UTSW 6 124841681 missense probably damaging 1.00
R0605:P3h3 UTSW 6 124856035 missense probably damaging 1.00
R0793:P3h3 UTSW 6 124854933 missense probably benign 0.00
R0794:P3h3 UTSW 6 124854933 missense probably benign 0.00
R0795:P3h3 UTSW 6 124854933 missense probably benign 0.00
R0796:P3h3 UTSW 6 124854933 missense probably benign 0.00
R0853:P3h3 UTSW 6 124854933 missense probably benign 0.00
R0854:P3h3 UTSW 6 124854933 missense probably benign 0.00
R0856:P3h3 UTSW 6 124854933 missense probably benign 0.00
R0893:P3h3 UTSW 6 124845513 missense probably damaging 1.00
R1819:P3h3 UTSW 6 124854932 missense probably benign 0.05
R2100:P3h3 UTSW 6 124845042 missense probably damaging 1.00
R4332:P3h3 UTSW 6 124842136 missense probably damaging 1.00
R4461:P3h3 UTSW 6 124845568 missense probably benign 0.08
R4533:P3h3 UTSW 6 124854408 missense possibly damaging 0.62
R4829:P3h3 UTSW 6 124841638 utr 3 prime probably benign
R4840:P3h3 UTSW 6 124850637 missense possibly damaging 0.82
R4962:P3h3 UTSW 6 124841773 missense probably benign 0.09
R5014:P3h3 UTSW 6 124855236 missense probably damaging 1.00
R5591:P3h3 UTSW 6 124854695 unclassified probably benign
R5691:P3h3 UTSW 6 124855153 missense probably damaging 1.00
R5777:P3h3 UTSW 6 124855958 missense probably benign 0.24
R5846:P3h3 UTSW 6 124857194 critical splice donor site probably null
R6212:P3h3 UTSW 6 124845643 missense probably benign 0.19
R6254:P3h3 UTSW 6 124845601 missense probably damaging 1.00
R6320:P3h3 UTSW 6 124854872 missense probably benign 0.02
R7385:P3h3 UTSW 6 124855270 missense probably damaging 1.00
X0021:P3h3 UTSW 6 124856029 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTAAGACAGTCAGTAGGCTTGG -3'
(R):5'- TCCAGCAGGTTTCTTTGGC -3'

Sequencing Primer
(F):5'- CAGTAGGCTTGGGGTAGCAC -3'
(R):5'- AGCAGGTTTCTTTGGCATCAC -3'
Posted On2018-09-12