Incidental Mutation 'R6860:9930012K11Rik'
ID535468
Institutional Source Beutler Lab
Gene Symbol 9930012K11Rik
Ensembl Gene ENSMUSG00000044551
Gene NameRIKEN cDNA 9930012K11 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6860 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location70154405-70159502 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 70157622 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 28 (V28L)
Ref Sequence ENSEMBL: ENSMUSP00000122309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035612] [ENSMUST00000058240] [ENSMUST00000129767] [ENSMUST00000153871]
Predicted Effect probably benign
Transcript: ENSMUST00000035612
SMART Domains Protein: ENSMUSP00000036924
Gene: ENSMUSG00000033712

DomainStartEndE-ValueType
low complexity region 23 37 N/A INTRINSIC
Pfam:S1-like 55 112 1.3e-29 PFAM
DBC1 339 462 8.48e-73 SMART
low complexity region 496 507 N/A INTRINSIC
low complexity region 534 545 N/A INTRINSIC
low complexity region 563 601 N/A INTRINSIC
low complexity region 627 640 N/A INTRINSIC
low complexity region 647 660 N/A INTRINSIC
SCOP:d2mysb_ 703 747 2e-3 SMART
Blast:HDc 704 758 7e-7 BLAST
coiled coil region 828 898 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000058240
AA Change: V28L

PolyPhen 2 Score 0.385 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000061834
Gene: ENSMUSG00000044551
AA Change: V28L

DomainStartEndE-ValueType
Pfam:DUF4657 78 366 1e-142 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129767
Predicted Effect possibly damaging
Transcript: ENSMUST00000153871
AA Change: V28L

PolyPhen 2 Score 0.744 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000122309
Gene: ENSMUSG00000044551
AA Change: V28L

DomainStartEndE-ValueType
Pfam:DUF4657 78 365 1.4e-132 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 100% (86/86)
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A G 11: 23,625,100 L58P probably damaging Het
4933427D14Rik T C 11: 72,189,586 E418G probably damaging Het
Abtb2 C T 2: 103,709,425 R712* probably null Het
Acvr1c C T 2: 58,287,705 G171S probably damaging Het
Ahctf1 G T 1: 179,753,288 A1783E probably benign Het
Anapc4 A T 5: 52,848,828 Q149L probably damaging Het
Ankrd27 T C 7: 35,628,527 V824A possibly damaging Het
Ankrd31 G C 13: 96,831,586 C577S probably benign Het
Apol7c T C 15: 77,526,074 N224S probably benign Het
Arl14 A T 3: 69,222,696 T59S probably benign Het
Astn1 T A 1: 158,612,472 I870K probably damaging Het
B4galt1 A T 4: 40,807,796 V335E probably benign Het
C2cd3 C T 7: 100,390,241 P216S probably benign Het
Cchcr1 C A 17: 35,529,118 N711K possibly damaging Het
Chd2 A G 7: 73,497,810 F467L possibly damaging Het
Cntn6 A T 6: 104,861,946 E987V possibly damaging Het
Col11a2 T A 17: 34,053,598 L286H probably damaging Het
Cwc22 C T 2: 77,929,448 R85Q possibly damaging Het
Cyp7a1 A C 4: 6,272,587 F209V probably damaging Het
Dmtn T C 14: 70,614,882 T189A possibly damaging Het
Dnhd1 C G 7: 105,678,266 N777K probably benign Het
Dusp16 A T 6: 134,725,879 C216* probably null Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fbn1 T C 2: 125,328,158 N1993S probably damaging Het
Fbxw22 A G 9: 109,383,962 S306P probably benign Het
Ferd3l T C 12: 33,928,652 S55P probably benign Het
Fpr-rs3 A G 17: 20,624,298 S194P possibly damaging Het
Gm19965 G A 1: 116,820,879 D97N probably benign Het
Gtpbp2 A G 17: 46,167,988 probably benign Het
Hcn3 A C 3: 89,159,845 I72S possibly damaging Het
Hist1h3f G T 13: 23,544,590 V36L probably benign Het
Hk3 T A 13: 55,014,465 N109Y probably damaging Het
Iqub T C 6: 24,505,738 E57G possibly damaging Het
Kcnk3 T A 5: 30,622,053 M149K possibly damaging Het
Kcp C T 6: 29,505,720 G51D probably benign Het
Kif26a C A 12: 112,146,829 A53D probably damaging Het
Lifr T A 15: 7,172,937 I353K probably benign Het
Llph A T 10: 120,231,284 N102I probably damaging Het
Lmo3 C A 6: 138,416,568 R18L possibly damaging Het
Lrrc46 T C 11: 97,035,545 E175G probably benign Het
Ltk A T 2: 119,754,594 C128* probably null Het
Map1b T C 13: 99,434,767 E482G probably damaging Het
Mapk8ip2 T C 15: 89,460,452 V740A probably damaging Het
Miga2 T C 2: 30,371,163 W157R probably benign Het
Mlip A G 9: 77,102,393 *837Q probably null Het
Mroh2a G T 1: 88,254,935 R1195L possibly damaging Het
Myl1 T C 1: 66,945,058 probably benign Het
Olfr365 T C 2: 37,202,177 L312P possibly damaging Het
Olfr448 T C 6: 42,896,816 Y122H probably benign Het
Olfr613 A G 7: 103,551,868 I28V probably benign Het
P3h3 A T 6: 124,857,368 V107D probably benign Het
Papolb A T 5: 142,528,896 S331T possibly damaging Het
Pars2 T G 4: 106,654,503 V494G probably benign Het
Pcdhb3 C A 18: 37,301,710 T243K probably benign Het
Pde9a T A 17: 31,470,724 M415K probably damaging Het
Ppp1r9b G A 11: 94,992,148 A201T probably benign Het
Prl A G 13: 27,064,959 N197S possibly damaging Het
Prl2c1 T A 13: 27,851,741 M32K probably benign Het
Prrt4 T C 6: 29,170,738 S572G possibly damaging Het
Psd T A 19: 46,322,419 D397V probably damaging Het
Psme2b A T 11: 48,945,480 Y213* probably null Het
Ptcd3 T A 6: 71,897,110 probably null Het
Ptprk T G 10: 28,334,484 F167L probably damaging Het
Rfx7 T C 9: 72,616,944 V472A probably damaging Het
Scnn1g T C 7: 121,740,353 L125S probably damaging Het
Sec16a T C 2: 26,430,112 Y1438C probably damaging Het
Serinc3 C T 2: 163,634,446 S155N probably benign Het
Slc3a2 A T 19: 8,713,632 V78E probably damaging Het
Slc44a4 T A 17: 34,921,068 L23Q probably damaging Het
Slco5a1 C T 1: 12,881,196 probably benign Het
Slit1 A G 19: 41,616,715 M899T probably benign Het
Sorl1 A G 9: 42,022,392 I1094T probably benign Het
Spag9 T A 11: 94,081,370 L258Q probably benign Het
Strip1 T C 3: 107,618,936 E488G possibly damaging Het
Stx18 G A 5: 38,104,891 D30N possibly damaging Het
Sync T C 4: 129,287,790 probably null Het
Syncrip A G 9: 88,476,796 V220A probably damaging Het
Tagln2 T C 1: 172,505,909 I110T probably benign Het
Taok1 T C 11: 77,541,801 T729A probably benign Het
Tgfbrap1 C T 1: 43,067,599 V75I possibly damaging Het
Tnfrsf21 A G 17: 43,017,066 T24A probably benign Het
Tnxb T A 17: 34,713,157 D2221E probably damaging Het
Triml1 A G 8: 43,130,566 S333P probably damaging Het
Trp53bp1 C A 2: 121,199,113 R1862L probably damaging Het
Tsc22d1 T G 14: 76,418,292 I737S possibly damaging Het
U2af2 A T 7: 5,079,274 K462N possibly damaging Het
Ubap2 A C 4: 41,233,631 N86K probably damaging Het
Uso1 A G 5: 92,195,348 K764E probably benign Het
Vmn1r192 T A 13: 22,187,952 M33L probably benign Het
Other mutations in 9930012K11Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02673:9930012K11Rik APN 14 70157607 missense probably benign 0.21
IGL03226:9930012K11Rik APN 14 70157609 missense probably damaging 0.97
R0125:9930012K11Rik UTSW 14 70156647 splice site probably benign
R0544:9930012K11Rik UTSW 14 70157314 missense probably benign 0.00
R1630:9930012K11Rik UTSW 14 70157180 missense probably benign 0.17
R4546:9930012K11Rik UTSW 14 70156478 missense probably benign 0.22
R4822:9930012K11Rik UTSW 14 70156458 missense probably benign 0.12
R4846:9930012K11Rik UTSW 14 70155943 missense probably damaging 1.00
R5211:9930012K11Rik UTSW 14 70156784 missense probably benign 0.00
R7286:9930012K11Rik UTSW 14 70157237 missense possibly damaging 0.77
R7319:9930012K11Rik UTSW 14 70156186 missense probably benign
X0064:9930012K11Rik UTSW 14 70156772 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCAGAGAATCTTGAGAAAGTCCTG -3'
(R):5'- CTTCCAAGCAAGGCTGGAAC -3'

Sequencing Primer
(F):5'- TCTTGAGAAAGTCCTGATAAGGTAGC -3'
(R):5'- CAAGGCTGGAACTTTATCCCAGTG -3'
Posted On2018-09-12