Incidental Mutation 'R6860:Dmtn'
ID535469
Institutional Source Beutler Lab
Gene Symbol Dmtn
Ensembl Gene ENSMUSG00000022099
Gene Namedematin actin binding protein
SynonymsEpb4.9, dematin
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.170) question?
Stock #R6860 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location70601263-70636048 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70614882 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 189 (T189A)
Ref Sequence ENSEMBL: ENSMUSP00000022694 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022694] [ENSMUST00000022695] [ENSMUST00000110984] [ENSMUST00000226543] [ENSMUST00000227331] [ENSMUST00000228001] [ENSMUST00000228009] [ENSMUST00000228295] [ENSMUST00000228824]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022694
AA Change: T189A

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000022694
Gene: ENSMUSG00000022099
AA Change: T189A

DomainStartEndE-ValueType
Pfam:AbLIM_anchor 8 93 8e-30 PFAM
Pfam:AbLIM_anchor 79 347 1.9e-58 PFAM
VHP 348 383 1.88e-18 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000022695
AA Change: T164A

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000022695
Gene: ENSMUSG00000022099
AA Change: T164A

DomainStartEndE-ValueType
low complexity region 60 72 N/A INTRINSIC
low complexity region 88 99 N/A INTRINSIC
low complexity region 149 160 N/A INTRINSIC
coiled coil region 188 220 N/A INTRINSIC
low complexity region 252 267 N/A INTRINSIC
VHP 345 380 1.88e-18 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000110984
AA Change: T189A

PolyPhen 2 Score 0.903 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106612
Gene: ENSMUSG00000022099
AA Change: T189A

DomainStartEndE-ValueType
low complexity region 11 29 N/A INTRINSIC
low complexity region 85 97 N/A INTRINSIC
low complexity region 113 124 N/A INTRINSIC
low complexity region 174 185 N/A INTRINSIC
coiled coil region 213 245 N/A INTRINSIC
low complexity region 277 292 N/A INTRINSIC
VHP 348 383 1.88e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000226543
Predicted Effect probably benign
Transcript: ENSMUST00000227331
Predicted Effect possibly damaging
Transcript: ENSMUST00000228001
AA Change: T164A

PolyPhen 2 Score 0.566 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000228009
AA Change: T189A

PolyPhen 2 Score 0.903 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000228295
AA Change: T164A

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000228824
AA Change: T164A

PolyPhen 2 Score 0.566 (Sensitivity: 0.88; Specificity: 0.91)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 100% (86/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an actin binding and bundling protein that plays a structural role in erythrocytes, by stabilizing and attaching the spectrin/actin cytoskeleton to the erythrocyte membrane in a phosphorylation-dependent manner. This protein contains a core domain in the N-terminus, and a headpiece domain in the C-terminus that binds F-actin. When purified from erythrocytes, this protein exists as a trimer composed of two 48 kDa polypeptides and a 52 kDa polypeptide. The different subunits arise from alternative splicing in the 3' coding region, where the headpiece domain is located. Disruption of this gene has been correlated with the autosomal dominant Marie Unna hereditary hypotrichosis disease, while loss of heterozygosity of this gene is thought to play a role in prostate cancer progression. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Nov 2014]
PHENOTYPE: Mice homozygous for a targeted mutation display mild anemia and spherocytosis. Mutant erythrocytes are osmotically fragile and show reduced deformability and filterability as well as increased membrane fragmentation and selective loss of spectrin and actin from RBC membrane skeletons and vesicles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A G 11: 23,625,100 L58P probably damaging Het
4933427D14Rik T C 11: 72,189,586 E418G probably damaging Het
9930012K11Rik C A 14: 70,157,622 V28L possibly damaging Het
Abtb2 C T 2: 103,709,425 R712* probably null Het
Acvr1c C T 2: 58,287,705 G171S probably damaging Het
Ahctf1 G T 1: 179,753,288 A1783E probably benign Het
Anapc4 A T 5: 52,848,828 Q149L probably damaging Het
Ankrd27 T C 7: 35,628,527 V824A possibly damaging Het
Ankrd31 G C 13: 96,831,586 C577S probably benign Het
Apol7c T C 15: 77,526,074 N224S probably benign Het
Arl14 A T 3: 69,222,696 T59S probably benign Het
Astn1 T A 1: 158,612,472 I870K probably damaging Het
B4galt1 A T 4: 40,807,796 V335E probably benign Het
C2cd3 C T 7: 100,390,241 P216S probably benign Het
Cchcr1 C A 17: 35,529,118 N711K possibly damaging Het
Chd2 A G 7: 73,497,810 F467L possibly damaging Het
Cntn6 A T 6: 104,861,946 E987V possibly damaging Het
Col11a2 T A 17: 34,053,598 L286H probably damaging Het
Cwc22 C T 2: 77,929,448 R85Q possibly damaging Het
Cyp7a1 A C 4: 6,272,587 F209V probably damaging Het
Dnhd1 C G 7: 105,678,266 N777K probably benign Het
Dusp16 A T 6: 134,725,879 C216* probably null Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fbn1 T C 2: 125,328,158 N1993S probably damaging Het
Fbxw22 A G 9: 109,383,962 S306P probably benign Het
Ferd3l T C 12: 33,928,652 S55P probably benign Het
Fpr-rs3 A G 17: 20,624,298 S194P possibly damaging Het
Gm19965 G A 1: 116,820,879 D97N probably benign Het
Gtpbp2 A G 17: 46,167,988 probably benign Het
Hcn3 A C 3: 89,159,845 I72S possibly damaging Het
Hist1h3f G T 13: 23,544,590 V36L probably benign Het
Hk3 T A 13: 55,014,465 N109Y probably damaging Het
Iqub T C 6: 24,505,738 E57G possibly damaging Het
Kcnk3 T A 5: 30,622,053 M149K possibly damaging Het
Kcp C T 6: 29,505,720 G51D probably benign Het
Kif26a C A 12: 112,146,829 A53D probably damaging Het
Lifr T A 15: 7,172,937 I353K probably benign Het
Llph A T 10: 120,231,284 N102I probably damaging Het
Lmo3 C A 6: 138,416,568 R18L possibly damaging Het
Lrrc46 T C 11: 97,035,545 E175G probably benign Het
Ltk A T 2: 119,754,594 C128* probably null Het
Map1b T C 13: 99,434,767 E482G probably damaging Het
Mapk8ip2 T C 15: 89,460,452 V740A probably damaging Het
Miga2 T C 2: 30,371,163 W157R probably benign Het
Mlip A G 9: 77,102,393 *837Q probably null Het
Mroh2a G T 1: 88,254,935 R1195L possibly damaging Het
Myl1 T C 1: 66,945,058 probably benign Het
Olfr365 T C 2: 37,202,177 L312P possibly damaging Het
Olfr448 T C 6: 42,896,816 Y122H probably benign Het
Olfr613 A G 7: 103,551,868 I28V probably benign Het
P3h3 A T 6: 124,857,368 V107D probably benign Het
Papolb A T 5: 142,528,896 S331T possibly damaging Het
Pars2 T G 4: 106,654,503 V494G probably benign Het
Pcdhb3 C A 18: 37,301,710 T243K probably benign Het
Pde9a T A 17: 31,470,724 M415K probably damaging Het
Ppp1r9b G A 11: 94,992,148 A201T probably benign Het
Prl A G 13: 27,064,959 N197S possibly damaging Het
Prl2c1 T A 13: 27,851,741 M32K probably benign Het
Prrt4 T C 6: 29,170,738 S572G possibly damaging Het
Psd T A 19: 46,322,419 D397V probably damaging Het
Psme2b A T 11: 48,945,480 Y213* probably null Het
Ptcd3 T A 6: 71,897,110 probably null Het
Ptprk T G 10: 28,334,484 F167L probably damaging Het
Rfx7 T C 9: 72,616,944 V472A probably damaging Het
Scnn1g T C 7: 121,740,353 L125S probably damaging Het
Sec16a T C 2: 26,430,112 Y1438C probably damaging Het
Serinc3 C T 2: 163,634,446 S155N probably benign Het
Slc3a2 A T 19: 8,713,632 V78E probably damaging Het
Slc44a4 T A 17: 34,921,068 L23Q probably damaging Het
Slco5a1 C T 1: 12,881,196 probably benign Het
Slit1 A G 19: 41,616,715 M899T probably benign Het
Sorl1 A G 9: 42,022,392 I1094T probably benign Het
Spag9 T A 11: 94,081,370 L258Q probably benign Het
Strip1 T C 3: 107,618,936 E488G possibly damaging Het
Stx18 G A 5: 38,104,891 D30N possibly damaging Het
Sync T C 4: 129,287,790 probably null Het
Syncrip A G 9: 88,476,796 V220A probably damaging Het
Tagln2 T C 1: 172,505,909 I110T probably benign Het
Taok1 T C 11: 77,541,801 T729A probably benign Het
Tgfbrap1 C T 1: 43,067,599 V75I possibly damaging Het
Tnfrsf21 A G 17: 43,017,066 T24A probably benign Het
Tnxb T A 17: 34,713,157 D2221E probably damaging Het
Triml1 A G 8: 43,130,566 S333P probably damaging Het
Trp53bp1 C A 2: 121,199,113 R1862L probably damaging Het
Tsc22d1 T G 14: 76,418,292 I737S possibly damaging Het
U2af2 A T 7: 5,079,274 K462N possibly damaging Het
Ubap2 A C 4: 41,233,631 N86K probably damaging Het
Uso1 A G 5: 92,195,348 K764E probably benign Het
Vmn1r192 T A 13: 22,187,952 M33L probably benign Het
Other mutations in Dmtn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01802:Dmtn APN 14 70604819 missense probably damaging 1.00
IGL02836:Dmtn APN 14 70616078 missense probably damaging 1.00
R1248:Dmtn UTSW 14 70612658 splice site probably benign
R2428:Dmtn UTSW 14 70613403 missense probably damaging 1.00
R3438:Dmtn UTSW 14 70612716 missense probably damaging 0.98
R4851:Dmtn UTSW 14 70604814 missense probably damaging 1.00
R4917:Dmtn UTSW 14 70605719 missense probably damaging 0.98
R4924:Dmtn UTSW 14 70617959 missense probably benign 0.25
R5633:Dmtn UTSW 14 70604979 missense probably benign 0.18
R6170:Dmtn UTSW 14 70617355 missense probably damaging 1.00
R6214:Dmtn UTSW 14 70613336 missense probably benign 0.05
R6215:Dmtn UTSW 14 70613336 missense probably benign 0.05
R6639:Dmtn UTSW 14 70617430 missense probably damaging 1.00
R7139:Dmtn UTSW 14 70617427 missense probably benign 0.12
R7242:Dmtn UTSW 14 70618020 missense probably damaging 1.00
R7380:Dmtn UTSW 14 70617328 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCTGTGCACAGTAACACAAAG -3'
(R):5'- TGGATCAGCTGAGTTCTCCG -3'

Sequencing Primer
(F):5'- TGTGCACAGTAACACAAAGAAGTAC -3'
(R):5'- CAGCTGAGTTCTCCGTGGGTG -3'
Posted On2018-09-12