Incidental Mutation 'R6860:Psd'
ID535485
Institutional Source Beutler Lab
Gene Symbol Psd
Ensembl Gene ENSMUSG00000037126
Gene Namepleckstrin and Sec7 domain containing
SynonymsPsdl, Efa6a, Efa6, 1110007H17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6860 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location46312087-46327156 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 46322419 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 397 (D397V)
Ref Sequence ENSEMBL: ENSMUSP00000152942 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041391] [ENSMUST00000096029] [ENSMUST00000223903] [ENSMUST00000223917] [ENSMUST00000224447] [ENSMUST00000224556] [ENSMUST00000225323] [ENSMUST00000225781]
Predicted Effect probably damaging
Transcript: ENSMUST00000041391
AA Change: D397V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000039728
Gene: ENSMUSG00000037126
AA Change: D397V

DomainStartEndE-ValueType
low complexity region 48 63 N/A INTRINSIC
low complexity region 79 99 N/A INTRINSIC
low complexity region 329 368 N/A INTRINSIC
low complexity region 419 431 N/A INTRINSIC
low complexity region 445 466 N/A INTRINSIC
Sec7 519 708 5.08e-75 SMART
low complexity region 714 724 N/A INTRINSIC
low complexity region 736 744 N/A INTRINSIC
PH 757 871 1.87e-13 SMART
Blast:Sec7 900 952 1e-6 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000096029
AA Change: D397V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093729
Gene: ENSMUSG00000037126
AA Change: D397V

DomainStartEndE-ValueType
low complexity region 48 63 N/A INTRINSIC
low complexity region 79 99 N/A INTRINSIC
low complexity region 329 368 N/A INTRINSIC
low complexity region 419 431 N/A INTRINSIC
low complexity region 445 466 N/A INTRINSIC
Sec7 520 709 5.08e-75 SMART
low complexity region 715 725 N/A INTRINSIC
low complexity region 737 745 N/A INTRINSIC
PH 758 872 1.87e-13 SMART
Blast:Sec7 901 953 1e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000223903
Predicted Effect probably benign
Transcript: ENSMUST00000223917
Predicted Effect probably benign
Transcript: ENSMUST00000224447
Predicted Effect probably benign
Transcript: ENSMUST00000224556
Predicted Effect probably damaging
Transcript: ENSMUST00000225323
AA Change: D397V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000225781
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 100% (86/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Plekstrin homology and SEC7 domains-containing protein that functions as a guanine nucleotide exchange factor. The encoded protein regulates signal transduction by activating ADP-ribosylation factor 6. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A G 11: 23,625,100 L58P probably damaging Het
4933427D14Rik T C 11: 72,189,586 E418G probably damaging Het
9930012K11Rik C A 14: 70,157,622 V28L possibly damaging Het
Abtb2 C T 2: 103,709,425 R712* probably null Het
Acvr1c C T 2: 58,287,705 G171S probably damaging Het
Ahctf1 G T 1: 179,753,288 A1783E probably benign Het
Anapc4 A T 5: 52,848,828 Q149L probably damaging Het
Ankrd27 T C 7: 35,628,527 V824A possibly damaging Het
Ankrd31 G C 13: 96,831,586 C577S probably benign Het
Apol7c T C 15: 77,526,074 N224S probably benign Het
Arl14 A T 3: 69,222,696 T59S probably benign Het
Astn1 T A 1: 158,612,472 I870K probably damaging Het
B4galt1 A T 4: 40,807,796 V335E probably benign Het
C2cd3 C T 7: 100,390,241 P216S probably benign Het
Cchcr1 C A 17: 35,529,118 N711K possibly damaging Het
Chd2 A G 7: 73,497,810 F467L possibly damaging Het
Cntn6 A T 6: 104,861,946 E987V possibly damaging Het
Col11a2 T A 17: 34,053,598 L286H probably damaging Het
Cwc22 C T 2: 77,929,448 R85Q possibly damaging Het
Cyp7a1 A C 4: 6,272,587 F209V probably damaging Het
Dmtn T C 14: 70,614,882 T189A possibly damaging Het
Dnhd1 C G 7: 105,678,266 N777K probably benign Het
Dusp16 A T 6: 134,725,879 C216* probably null Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fbn1 T C 2: 125,328,158 N1993S probably damaging Het
Fbxw22 A G 9: 109,383,962 S306P probably benign Het
Ferd3l T C 12: 33,928,652 S55P probably benign Het
Fpr-rs3 A G 17: 20,624,298 S194P possibly damaging Het
Gm19965 G A 1: 116,820,879 D97N probably benign Het
Gtpbp2 A G 17: 46,167,988 probably benign Het
Hcn3 A C 3: 89,159,845 I72S possibly damaging Het
Hist1h3f G T 13: 23,544,590 V36L probably benign Het
Hk3 T A 13: 55,014,465 N109Y probably damaging Het
Iqub T C 6: 24,505,738 E57G possibly damaging Het
Kcnk3 T A 5: 30,622,053 M149K possibly damaging Het
Kcp C T 6: 29,505,720 G51D probably benign Het
Kif26a C A 12: 112,146,829 A53D probably damaging Het
Lifr T A 15: 7,172,937 I353K probably benign Het
Llph A T 10: 120,231,284 N102I probably damaging Het
Lmo3 C A 6: 138,416,568 R18L possibly damaging Het
Lrrc46 T C 11: 97,035,545 E175G probably benign Het
Ltk A T 2: 119,754,594 C128* probably null Het
Map1b T C 13: 99,434,767 E482G probably damaging Het
Mapk8ip2 T C 15: 89,460,452 V740A probably damaging Het
Miga2 T C 2: 30,371,163 W157R probably benign Het
Mlip A G 9: 77,102,393 *837Q probably null Het
Mroh2a G T 1: 88,254,935 R1195L possibly damaging Het
Myl1 T C 1: 66,945,058 probably benign Het
Olfr365 T C 2: 37,202,177 L312P possibly damaging Het
Olfr448 T C 6: 42,896,816 Y122H probably benign Het
Olfr613 A G 7: 103,551,868 I28V probably benign Het
P3h3 A T 6: 124,857,368 V107D probably benign Het
Papolb A T 5: 142,528,896 S331T possibly damaging Het
Pars2 T G 4: 106,654,503 V494G probably benign Het
Pcdhb3 C A 18: 37,301,710 T243K probably benign Het
Pde9a T A 17: 31,470,724 M415K probably damaging Het
Ppp1r9b G A 11: 94,992,148 A201T probably benign Het
Prl A G 13: 27,064,959 N197S possibly damaging Het
Prl2c1 T A 13: 27,851,741 M32K probably benign Het
Prrt4 T C 6: 29,170,738 S572G possibly damaging Het
Psme2b A T 11: 48,945,480 Y213* probably null Het
Ptcd3 T A 6: 71,897,110 probably null Het
Ptprk T G 10: 28,334,484 F167L probably damaging Het
Rfx7 T C 9: 72,616,944 V472A probably damaging Het
Scnn1g T C 7: 121,740,353 L125S probably damaging Het
Sec16a T C 2: 26,430,112 Y1438C probably damaging Het
Serinc3 C T 2: 163,634,446 S155N probably benign Het
Slc3a2 A T 19: 8,713,632 V78E probably damaging Het
Slc44a4 T A 17: 34,921,068 L23Q probably damaging Het
Slco5a1 C T 1: 12,881,196 probably benign Het
Slit1 A G 19: 41,616,715 M899T probably benign Het
Sorl1 A G 9: 42,022,392 I1094T probably benign Het
Spag9 T A 11: 94,081,370 L258Q probably benign Het
Strip1 T C 3: 107,618,936 E488G possibly damaging Het
Stx18 G A 5: 38,104,891 D30N possibly damaging Het
Sync T C 4: 129,287,790 probably null Het
Syncrip A G 9: 88,476,796 V220A probably damaging Het
Tagln2 T C 1: 172,505,909 I110T probably benign Het
Taok1 T C 11: 77,541,801 T729A probably benign Het
Tgfbrap1 C T 1: 43,067,599 V75I possibly damaging Het
Tnfrsf21 A G 17: 43,017,066 T24A probably benign Het
Tnxb T A 17: 34,713,157 D2221E probably damaging Het
Triml1 A G 8: 43,130,566 S333P probably damaging Het
Trp53bp1 C A 2: 121,199,113 R1862L probably damaging Het
Tsc22d1 T G 14: 76,418,292 I737S possibly damaging Het
U2af2 A T 7: 5,079,274 K462N possibly damaging Het
Ubap2 A C 4: 41,233,631 N86K probably damaging Het
Uso1 A G 5: 92,195,348 K764E probably benign Het
Vmn1r192 T A 13: 22,187,952 M33L probably benign Het
Other mutations in Psd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01291:Psd APN 19 46314747 missense possibly damaging 0.77
IGL01307:Psd APN 19 46314658 missense probably damaging 1.00
IGL02329:Psd APN 19 46319659 missense possibly damaging 0.66
IGL02423:Psd APN 19 46314504 missense possibly damaging 0.95
IGL02644:Psd APN 19 46323395 missense probably damaging 1.00
IGL02724:Psd APN 19 46319545 missense probably benign 0.04
IGL03117:Psd APN 19 46323122 unclassified probably benign
ANU05:Psd UTSW 19 46314747 missense possibly damaging 0.77
P0035:Psd UTSW 19 46320961 missense possibly damaging 0.56
R0054:Psd UTSW 19 46323342 missense probably damaging 1.00
R0054:Psd UTSW 19 46323342 missense probably damaging 1.00
R0403:Psd UTSW 19 46320972 unclassified probably benign
R0499:Psd UTSW 19 46322161 missense probably damaging 0.98
R0542:Psd UTSW 19 46314210 missense probably damaging 1.00
R0543:Psd UTSW 19 46319517 missense possibly damaging 0.62
R0894:Psd UTSW 19 46313441 missense probably damaging 1.00
R1449:Psd UTSW 19 46324811 missense probably damaging 0.99
R1586:Psd UTSW 19 46314798 missense probably damaging 0.98
R2096:Psd UTSW 19 46324649 unclassified probably null
R2504:Psd UTSW 19 46324913 missense possibly damaging 0.90
R2857:Psd UTSW 19 46324420 missense probably benign 0.00
R2863:Psd UTSW 19 46314762 missense probably damaging 0.97
R3897:Psd UTSW 19 46324585 missense possibly damaging 0.93
R3967:Psd UTSW 19 46324406 missense probably benign
R3970:Psd UTSW 19 46324406 missense probably benign
R4435:Psd UTSW 19 46314494 missense probably damaging 1.00
R4612:Psd UTSW 19 46313339 missense probably benign 0.15
R4940:Psd UTSW 19 46322417 missense probably damaging 1.00
R5055:Psd UTSW 19 46322468 missense probably benign 0.00
R5485:Psd UTSW 19 46316089 splice site probably null
R5768:Psd UTSW 19 46312739 missense possibly damaging 0.84
R5775:Psd UTSW 19 46314772 nonsense probably null
R6057:Psd UTSW 19 46323314 missense possibly damaging 0.77
R6349:Psd UTSW 19 46313387 unclassified probably null
R6496:Psd UTSW 19 46320314 missense probably damaging 1.00
R6614:Psd UTSW 19 46313412 missense probably benign 0.11
R6820:Psd UTSW 19 46320844 missense probably damaging 1.00
R6849:Psd UTSW 19 46317746 missense probably damaging 0.97
R7286:Psd UTSW 19 46314801 missense probably damaging 0.98
R7326:Psd UTSW 19 46324454 missense probably benign 0.01
R7351:Psd UTSW 19 46322430 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- TGCCAGAATCAGGTTCAAGAGG -3'
(R):5'- GGGACACTGAACTTCATGAGG -3'

Sequencing Primer
(F):5'- CAGGTGCAGGTGGGTCAG -3'
(R):5'- CACTGAACTTCATGAGGTTTTGGATC -3'
Posted On2018-09-12