Incidental Mutation 'R6850:Olfr1537'
ID535599
Institutional Source Beutler Lab
Gene Symbol Olfr1537
Ensembl Gene ENSMUSG00000096109
Gene Nameolfactory receptor 1537
SynonymsMOR171-41P, MOR171-32P, GA_x6K02T2PVTD-32935684-32934749, Olfr1537-ps1, K4, MOR171-32P, Olfr144
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R6850 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location39234412-39249994 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 39237975 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 150 (I150V)
Ref Sequence ENSEMBL: ENSMUSP00000149992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073248] [ENSMUST00000213472]
Predicted Effect probably benign
Transcript: ENSMUST00000073248
AA Change: I153V

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000072979
Gene: ENSMUSG00000096109
AA Change: I153V

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 2.4e-51 PFAM
Pfam:7tm_1 44 293 1.1e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213472
AA Change: I150V

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik ACTGCACCACCT ACT 10: 43,532,725 probably benign Het
4932415D10Rik A C 10: 82,293,054 M1374R possibly damaging Het
Adgb T C 10: 10,394,574 M927V probably benign Het
Agr2 A G 12: 35,995,559 I15V probably benign Het
Alpk1 A G 3: 127,729,363 I10T possibly damaging Het
Art5 A G 7: 102,098,095 V159A possibly damaging Het
Asz1 G A 6: 18,108,943 R32W probably benign Het
Atp8b1 A C 18: 64,556,852 M603R possibly damaging Het
Cacna1s G A 1: 136,092,694 R823Q probably benign Het
Car9 A G 4: 43,507,321 E3G probably damaging Het
Cpne3 A T 4: 19,535,231 I267N possibly damaging Het
Cyp2c65 T A 19: 39,069,091 F57I probably benign Het
D430041D05Rik T C 2: 104,201,259 K980R probably damaging Het
Dnhd1 G T 7: 105,719,930 G4303W possibly damaging Het
Dnmt3a A G 12: 3,897,600 N485D probably benign Het
Dusp4 A T 8: 34,816,497 K166* probably null Het
Ect2 T C 3: 27,138,885 D344G probably damaging Het
Eif2b1 T C 5: 124,579,006 D3G probably benign Het
Ermp1 A G 19: 29,616,641 Y710H probably damaging Het
Gar1 T C 3: 129,829,389 N117S probably damaging Het
Gm16486 A T 8: 70,710,776 N873Y probably damaging Het
Gm35339 A G 15: 76,357,796 Y763C probably damaging Het
H2-T10 A G 17: 36,119,260 L263P probably damaging Het
Itga7 A T 10: 128,945,516 I621F probably damaging Het
Kcna3 A T 3: 107,037,159 D246V probably damaging Het
Kctd12 C T 14: 102,981,978 G155S probably benign Het
Lrtm1 T C 14: 29,027,450 V256A probably benign Het
Mcf2l T C 8: 13,009,476 F629L possibly damaging Het
Mphosph9 A G 5: 124,260,956 F999L probably damaging Het
Obscn C T 11: 59,002,129 A6764T possibly damaging Het
Obscn C T 11: 59,068,124 V3643M possibly damaging Het
Olfr1189 T A 2: 88,592,306 C167* probably null Het
Pdhx T C 2: 103,041,100 H195R probably damaging Het
Pdilt A T 7: 119,486,959 V511E probably damaging Het
Prima1 C T 12: 103,197,335 D126N probably benign Het
Prrc2c TTGCTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGCTGCTGC 1: 162,709,061 probably benign Het
Prune2 C A 19: 17,122,188 D1685E probably benign Het
Ptgs2 A T 1: 150,105,540 I525F probably damaging Het
Rab11fip2 A T 19: 59,937,009 F259I possibly damaging Het
Ranbp3l C A 15: 9,058,727 D216E probably damaging Het
Scn5a A T 9: 119,501,749 L1240Q possibly damaging Het
Sohlh2 A T 3: 55,192,286 T160S probably benign Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Tank A G 2: 61,650,002 E294G probably benign Het
Tars T A 15: 11,392,799 Y187F probably benign Het
Tas2r144 T A 6: 42,215,923 M199K possibly damaging Het
Tdrd3 T C 14: 87,458,079 probably benign Het
Tecta T A 9: 42,343,838 D1683V probably benign Het
Tln2 A G 9: 67,258,535 I2098T probably damaging Het
Tmie A G 9: 110,866,912 I137T possibly damaging Het
Trim45 T A 3: 100,923,225 L105* probably null Het
Trpv3 G A 11: 73,291,693 G568S probably damaging Het
Wdr75 A G 1: 45,814,598 T390A probably benign Het
Zfp35 G A 18: 24,002,782 R61H possibly damaging Het
Other mutations in Olfr1537
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00981:Olfr1537 APN 9 39237605 missense probably benign 0.25
IGL01691:Olfr1537 APN 9 39238019 missense probably benign 0.00
IGL02606:Olfr1537 APN 9 39238194 missense probably damaging 0.98
IGL02656:Olfr1537 APN 9 39238160 missense probably benign 0.13
R0133:Olfr1537 UTSW 9 39238011 missense probably benign 0.00
R0548:Olfr1537 UTSW 9 39238371 missense probably benign 0.13
R0558:Olfr1537 UTSW 9 39238200 missense probably damaging 0.96
R0616:Olfr1537 UTSW 9 39237650 missense probably benign 0.00
R0626:Olfr1537 UTSW 9 39237866 missense possibly damaging 0.52
R0826:Olfr1537 UTSW 9 39238429 start codon destroyed probably null 0.00
R0839:Olfr1537 UTSW 9 39237850 missense possibly damaging 0.51
R1074:Olfr1537 UTSW 9 39238251 missense probably benign 0.39
R1224:Olfr1537 UTSW 9 39238251 missense probably benign 0.39
R1226:Olfr1537 UTSW 9 39238251 missense probably benign 0.39
R1252:Olfr1537 UTSW 9 39238251 missense probably benign 0.39
R1256:Olfr1537 UTSW 9 39238251 missense probably benign 0.39
R1355:Olfr1537 UTSW 9 39238251 missense probably benign 0.39
R1356:Olfr1537 UTSW 9 39238251 missense probably benign 0.39
R1416:Olfr1537 UTSW 9 39238251 missense probably benign 0.39
R1499:Olfr1537 UTSW 9 39238251 missense probably benign 0.39
R1658:Olfr1537 UTSW 9 39237959 missense probably benign 0.03
R1815:Olfr1537 UTSW 9 39237990 missense probably benign 0.01
R2198:Olfr1537 UTSW 9 39237752 missense possibly damaging 0.48
R4178:Olfr1537 UTSW 9 39238079 nonsense probably null
R5112:Olfr1537 UTSW 9 39238421 start codon destroyed probably null 0.94
R6251:Olfr1537 UTSW 9 39238218 missense possibly damaging 0.94
R7032:Olfr1537 UTSW 9 39237687 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- AATAATGGTCAGCACTGGGAC -3'
(R):5'- TCGTGAGCTTTCTGACAGAG -3'

Sequencing Primer
(F):5'- TCAGCACTGGGACAAATGAATTC -3'
(R):5'- TCGTGAGCTTTCTGACAGAGATGAAC -3'
Posted On2018-09-12