Incidental Mutation 'R6850:Trpv3'
ID535610
Institutional Source Beutler Lab
Gene Symbol Trpv3
Ensembl Gene ENSMUSG00000043029
Gene Nametransient receptor potential cation channel, subfamily V, member 3
SynonymsNh, VRL3, 1110036I10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock #R6850 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location73267388-73300363 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 73291693 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 568 (G568S)
Ref Sequence ENSEMBL: ENSMUSP00000053755 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049676]
PDB Structure
Crystal structure of the N-terminal ankyrin repeat domain of TRPV3 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000049676
AA Change: G568S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000053755
Gene: ENSMUSG00000043029
AA Change: G568S

DomainStartEndE-ValueType
low complexity region 81 92 N/A INTRINSIC
low complexity region 109 122 N/A INTRINSIC
low complexity region 133 153 N/A INTRINSIC
ANK 167 201 1.21e2 SMART
ANK 214 243 3.54e-1 SMART
ANK 261 291 1.36e-2 SMART
ANK 340 370 6.71e-2 SMART
low complexity region 417 431 N/A INTRINSIC
Pfam:Ion_trans 437 689 3.9e-9 PFAM
Meta Mutation Damage Score 0.29 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to a family of nonselective cation channels that function in a variety of processes, including temperature sensation and vasoregulation. The thermosensitive members of this family are expressed in subsets of sensory neurons that terminate in the skin, and are activated at distinct physiological temperatures. This channel is activated at temperatures between 22 and 40 degrees C. This gene lies in close proximity to another family member gene on chromosome 17, and the two encoded proteins are thought to associate with each other to form heteromeric channels. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Homozygous null mice have strong deficits in response to innocuous and noxious heat but not in other sensory modalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik ACTGCACCACCT ACT 10: 43,532,725 probably benign Het
4932415D10Rik A C 10: 82,293,054 M1374R possibly damaging Het
Adgb T C 10: 10,394,574 M927V probably benign Het
Agr2 A G 12: 35,995,559 I15V probably benign Het
Alpk1 A G 3: 127,729,363 I10T possibly damaging Het
Art5 A G 7: 102,098,095 V159A possibly damaging Het
Asz1 G A 6: 18,108,943 R32W probably benign Het
Atp8b1 A C 18: 64,556,852 M603R possibly damaging Het
Cacna1s G A 1: 136,092,694 R823Q probably benign Het
Car9 A G 4: 43,507,321 E3G probably damaging Het
Cpne3 A T 4: 19,535,231 I267N possibly damaging Het
Cyp2c65 T A 19: 39,069,091 F57I probably benign Het
D430041D05Rik T C 2: 104,201,259 K980R probably damaging Het
Dnhd1 G T 7: 105,719,930 G4303W possibly damaging Het
Dnmt3a A G 12: 3,897,600 N485D probably benign Het
Dusp4 A T 8: 34,816,497 K166* probably null Het
Ect2 T C 3: 27,138,885 D344G probably damaging Het
Eif2b1 T C 5: 124,579,006 D3G probably benign Het
Ermp1 A G 19: 29,616,641 Y710H probably damaging Het
Gar1 T C 3: 129,829,389 N117S probably damaging Het
Gm16486 A T 8: 70,710,776 N873Y probably damaging Het
Gm35339 A G 15: 76,357,796 Y763C probably damaging Het
H2-T10 A G 17: 36,119,260 L263P probably damaging Het
Itga7 A T 10: 128,945,516 I621F probably damaging Het
Kcna3 A T 3: 107,037,159 D246V probably damaging Het
Kctd12 C T 14: 102,981,978 G155S probably benign Het
Lrtm1 T C 14: 29,027,450 V256A probably benign Het
Mcf2l T C 8: 13,009,476 F629L possibly damaging Het
Mphosph9 A G 5: 124,260,956 F999L probably damaging Het
Obscn C T 11: 59,002,129 A6764T possibly damaging Het
Obscn C T 11: 59,068,124 V3643M possibly damaging Het
Olfr1189 T A 2: 88,592,306 C167* probably null Het
Olfr1537 T C 9: 39,237,975 I150V probably benign Het
Pdhx T C 2: 103,041,100 H195R probably damaging Het
Pdilt A T 7: 119,486,959 V511E probably damaging Het
Prima1 C T 12: 103,197,335 D126N probably benign Het
Prrc2c TTGCTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGCTGCTGC 1: 162,709,061 probably benign Het
Prune2 C A 19: 17,122,188 D1685E probably benign Het
Ptgs2 A T 1: 150,105,540 I525F probably damaging Het
Rab11fip2 A T 19: 59,937,009 F259I possibly damaging Het
Ranbp3l C A 15: 9,058,727 D216E probably damaging Het
Scn5a A T 9: 119,501,749 L1240Q possibly damaging Het
Sohlh2 A T 3: 55,192,286 T160S probably benign Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Tank A G 2: 61,650,002 E294G probably benign Het
Tars T A 15: 11,392,799 Y187F probably benign Het
Tas2r144 T A 6: 42,215,923 M199K possibly damaging Het
Tdrd3 T C 14: 87,458,079 probably benign Het
Tecta T A 9: 42,343,838 D1683V probably benign Het
Tln2 A G 9: 67,258,535 I2098T probably damaging Het
Tmie A G 9: 110,866,912 I137T possibly damaging Het
Trim45 T A 3: 100,923,225 L105* probably null Het
Wdr75 A G 1: 45,814,598 T390A probably benign Het
Zfp35 G A 18: 24,002,782 R61H possibly damaging Het
Other mutations in Trpv3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01084:Trpv3 APN 11 73294000 critical splice donor site probably null
IGL01161:Trpv3 APN 11 73296718 splice site probably benign
IGL02130:Trpv3 APN 11 73279770 missense probably benign 0.00
IGL02957:Trpv3 APN 11 73285872 missense probably damaging 1.00
IGL03334:Trpv3 APN 11 73281665 splice site probably benign
R0103:Trpv3 UTSW 11 73293979 missense probably damaging 1.00
R0103:Trpv3 UTSW 11 73293979 missense probably damaging 1.00
R0546:Trpv3 UTSW 11 73297187 missense probably damaging 1.00
R0685:Trpv3 UTSW 11 73296814 splice site probably benign
R0969:Trpv3 UTSW 11 73278938 nonsense probably null
R1748:Trpv3 UTSW 11 73295383 missense possibly damaging 0.84
R1974:Trpv3 UTSW 11 73283688 missense probably damaging 0.99
R2015:Trpv3 UTSW 11 73279827 missense probably damaging 0.97
R3426:Trpv3 UTSW 11 73285941 missense probably damaging 1.00
R3427:Trpv3 UTSW 11 73285941 missense probably damaging 1.00
R3428:Trpv3 UTSW 11 73285941 missense probably damaging 1.00
R3618:Trpv3 UTSW 11 73295455 missense probably damaging 1.00
R3712:Trpv3 UTSW 11 73278954 missense probably benign
R3916:Trpv3 UTSW 11 73283734 missense possibly damaging 0.87
R3917:Trpv3 UTSW 11 73283734 missense possibly damaging 0.87
R3961:Trpv3 UTSW 11 73287420 nonsense probably null
R4242:Trpv3 UTSW 11 73277823 missense probably benign 0.43
R4277:Trpv3 UTSW 11 73296438 missense probably damaging 0.97
R4506:Trpv3 UTSW 11 73295324 missense probably benign 0.40
R4629:Trpv3 UTSW 11 73281789 missense probably damaging 0.99
R4656:Trpv3 UTSW 11 73295414 missense probably damaging 1.00
R5059:Trpv3 UTSW 11 73295323 missense probably benign 0.00
R5121:Trpv3 UTSW 11 73277834 critical splice donor site probably null
R6113:Trpv3 UTSW 11 73286018 missense probably benign 0.10
R6130:Trpv3 UTSW 11 73296483 missense possibly damaging 0.49
R6342:Trpv3 UTSW 11 73283863 missense probably damaging 1.00
R7180:Trpv3 UTSW 11 73277992 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCTGCTGCTAAGTAAGGTCC -3'
(R):5'- GGGTCAGAACATTTCCCTCAC -3'

Sequencing Primer
(F):5'- GCTGCTAAGTAAGGTCCTTGTCC -3'
(R):5'- CAGCCCAGTTGTTTTAAAGTCTGAC -3'
Posted On2018-09-12