Incidental Mutation 'R6380:Tor1aip1'
ID535662
Institutional Source Beutler Lab
Gene Symbol Tor1aip1
Ensembl Gene ENSMUSG00000026466
Gene Nametorsin A interacting protein 1
SynonymsLAP1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6380 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location156004599-156036480 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 156018488 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 274 (E274G)
Ref Sequence ENSEMBL: ENSMUSP00000141619 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000130995]
Predicted Effect possibly damaging
Transcript: ENSMUST00000130995
AA Change: E274G

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000141619
Gene: ENSMUSG00000026466
AA Change: E274G

DomainStartEndE-ValueType
low complexity region 107 121 N/A INTRINSIC
Pfam:LAP1C 122 273 3.8e-36 PFAM
Meta Mutation Damage Score 0.0664 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.5%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type 2 integral membrane protein that binds A- and B-type lamins. The encoded protein localizes to the inner nuclear membrane and may be involved in maintaining the attachment of the nuclear membrane to the nuclear lamina during cell division. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit perinatal lethality and nuclear membrane blebs in neural and nonneural tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik G A 1: 93,160,891 probably null Het
4930590J08Rik G A 6: 91,923,137 G424D probably damaging Het
4932438A13Rik A G 3: 37,033,307 D4019G probably benign Het
Aco1 T C 4: 40,185,028 V566A probably benign Het
Adat1 G T 8: 111,978,072 T414K probably benign Het
Alox12e A G 11: 70,321,101 V194A probably benign Het
Anpep A G 7: 79,841,896 V119A probably benign Het
Atat1 C A 17: 35,908,957 probably null Het
Atp10a G A 7: 58,819,684 W1094* probably null Het
Bcl11b T C 12: 108,003,101 R15G probably benign Het
Btnl1 A G 17: 34,379,494 E28G probably benign Het
Ccnd1 A G 7: 144,939,569 V42A probably benign Het
Cdyl2 T A 8: 116,583,184 K344N probably damaging Het
Cep68 A G 11: 20,230,498 M711T probably benign Het
Cyp2j7 A G 4: 96,229,974 probably null Het
Cyp3a25 A T 5: 145,998,547 D86E probably damaging Het
Dclk1 G T 3: 55,247,194 R15L probably damaging Het
Dpy19l1 T A 9: 24,482,045 K143* probably null Het
Duox2 A G 2: 122,281,002 V1405A probably benign Het
Filip1 T C 9: 79,819,624 E571G probably damaging Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Jph1 T C 1: 17,091,847 N197S probably damaging Het
Kcnt2 T C 1: 140,509,584 L535S probably damaging Het
Lepr C A 4: 101,764,954 S361* probably null Het
Lfng T A 5: 140,614,396 probably null Het
Lpcat2 G A 8: 92,886,581 A250T probably benign Het
Map3k4 A T 17: 12,272,067 M159K possibly damaging Het
Notch3 A T 17: 32,144,559 C1177S probably damaging Het
Olfml2b C T 1: 170,669,231 P477L probably benign Het
Olfr180 T A 16: 58,916,264 I126L probably damaging Het
Olfr586 A T 7: 103,121,929 F281Y probably benign Het
Olfr820 A T 10: 130,017,913 H184L probably benign Het
Pald1 G T 10: 61,350,935 F146L possibly damaging Het
Pcdhga1 A G 18: 37,662,969 D342G probably damaging Het
Plcb2 T C 2: 118,715,468 S579G probably damaging Het
Prdm16 A T 4: 154,341,367 S654T probably benign Het
Rab3gap2 C A 1: 185,235,984 L178I probably damaging Het
Rbfox1 C T 16: 7,224,350 Q23* probably null Het
Slc14a2 T G 18: 78,146,975 T920P probably benign Het
Slc17a6 G A 7: 51,667,463 V411M probably benign Het
Stard6 G A 18: 70,476,388 V33I probably benign Het
Syce1 A T 7: 140,779,065 H178Q probably damaging Het
Syne2 T A 12: 76,104,980 F1872I probably damaging Het
Trpm1 A T 7: 64,268,297 T462S probably benign Het
Ugt3a1 C T 15: 9,306,455 A230V probably benign Het
Vmn1r178 A G 7: 23,893,559 T11A possibly damaging Het
Vmn2r69 A T 7: 85,411,859 N172K probably benign Het
Whrn G T 4: 63,418,592 P136T possibly damaging Het
Zfhx4 A G 3: 5,413,110 N3570S probably damaging Het
Zfp689 A G 7: 127,444,796 S221P probably damaging Het
Other mutations in Tor1aip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00656:Tor1aip1 APN 1 156031467 missense probably benign 0.01
IGL00837:Tor1aip1 APN 1 156006916 utr 3 prime probably benign
IGL02573:Tor1aip1 APN 1 156013371 missense probably damaging 0.99
IGL02815:Tor1aip1 APN 1 156035916 missense probably damaging 1.00
IGL02964:Tor1aip1 APN 1 156035844 missense probably damaging 0.96
IGL03128:Tor1aip1 APN 1 156007035 missense probably damaging 1.00
R0100:Tor1aip1 UTSW 1 156007075 missense probably damaging 1.00
R0319:Tor1aip1 UTSW 1 156007181 missense probably damaging 1.00
R0410:Tor1aip1 UTSW 1 156035940 missense possibly damaging 0.85
R0458:Tor1aip1 UTSW 1 156030407 missense probably damaging 0.99
R0506:Tor1aip1 UTSW 1 156007674 nonsense probably null
R0563:Tor1aip1 UTSW 1 156035808 missense probably damaging 1.00
R1696:Tor1aip1 UTSW 1 156017516 missense possibly damaging 0.67
R1745:Tor1aip1 UTSW 1 156030434 splice site probably null
R1830:Tor1aip1 UTSW 1 156007562 missense probably damaging 1.00
R2132:Tor1aip1 UTSW 1 156007562 missense probably damaging 1.00
R4487:Tor1aip1 UTSW 1 156007124 missense probably damaging 1.00
R5613:Tor1aip1 UTSW 1 156033753 missense probably damaging 0.98
R5657:Tor1aip1 UTSW 1 156007488 missense probably damaging 1.00
R6123:Tor1aip1 UTSW 1 156007205 missense probably damaging 1.00
R6647:Tor1aip1 UTSW 1 156018253 missense possibly damaging 0.94
R6852:Tor1aip1 UTSW 1 156035820 missense probably damaging 0.99
R7354:Tor1aip1 UTSW 1 156036113 missense probably damaging 0.98
R7463:Tor1aip1 UTSW 1 156007609 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- TCATGAGCTGGGAAGTCCTG -3'
(R):5'- CTTATCGTTGTCCAGTGCTAGG -3'

Sequencing Primer
(F):5'- CTGGGAAGTCCTGATCTAGAAC -3'
(R):5'- TTTAATCCCAGCACTCAGGAGG -3'
Posted On2018-10-05