Incidental Mutation 'R6862:Prr14l'
ID535684
Institutional Source Beutler Lab
Gene Symbol Prr14l
Ensembl Gene ENSMUSG00000054280
Gene Nameproline rich 14-like
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.191) question?
Stock #R6862 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location32789820-32854256 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32827759 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 1464 (L1464P)
Ref Sequence ENSEMBL: ENSMUSP00000113259 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120129] [ENSMUST00000144673] [ENSMUST00000155392]
Predicted Effect probably damaging
Transcript: ENSMUST00000120129
AA Change: L1464P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113259
Gene: ENSMUSG00000054280
AA Change: L1464P

DomainStartEndE-ValueType
low complexity region 720 731 N/A INTRINSIC
low complexity region 1433 1446 N/A INTRINSIC
low complexity region 1471 1480 N/A INTRINSIC
Pfam:Tantalus 1838 1895 2.9e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144673
SMART Domains Protein: ENSMUSP00000124923
Gene: ENSMUSG00000093574

DomainStartEndE-ValueType
Pfam:Tantalus 158 193 1.2e-15 PFAM
Pfam:PS_Dcarbxylase 332 575 2.1e-71 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000155392
AA Change: L307P

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000119569
Gene: ENSMUSG00000054280
AA Change: L307P

DomainStartEndE-ValueType
low complexity region 276 289 N/A INTRINSIC
low complexity region 314 323 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 98% (57/58)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik C T 3: 138,186,188 probably benign Het
Adgra2 C A 8: 27,113,436 H416Q probably benign Het
Adgra2 T A 8: 27,113,437 C417S probably damaging Het
Aff3 C A 1: 38,406,497 R307L possibly damaging Het
Arhgap17 T C 7: 123,321,901 D121G probably damaging Het
Ascc3 G T 10: 50,849,646 R2155I probably null Het
Ccdc115 C T 1: 34,439,283 S19N possibly damaging Het
Ccser2 T C 14: 36,940,081 N382S probably benign Het
Cct6b A T 11: 82,719,959 V500E probably damaging Het
Cenpo A T 12: 4,216,539 Y190N probably damaging Het
Cfh T A 1: 140,102,362 K924N probably damaging Het
Col4a1 A G 8: 11,202,926 probably benign Het
Coro1b T C 19: 4,150,771 V234A probably benign Het
Crot T C 5: 8,989,641 K69E probably damaging Het
Cyp2d11 A T 15: 82,390,138 H347Q probably benign Het
Fam71b G A 11: 46,407,591 G574D possibly damaging Het
Fbn2 T A 18: 58,124,321 I325F probably benign Het
Fbxw4 T A 19: 45,582,748 R41S probably benign Het
Fn1 T A 1: 71,613,907 I1308F probably benign Het
Frem1 C A 4: 83,012,014 E232* probably null Het
Gabrg3 T C 7: 56,773,311 Q213R possibly damaging Het
Gm11639 A T 11: 104,721,458 K636* probably null Het
Gm428 A G 4: 73,687,384 N344S probably benign Het
Gsdme A T 6: 50,227,398 V193E probably damaging Het
Hadha C A 5: 30,147,979 probably null Het
Hdgfl2 C A 17: 56,099,211 A533E probably damaging Het
Hivep2 T C 10: 14,130,583 F975S probably damaging Het
Htatip2 T A 7: 49,770,918 S171T probably benign Het
Ift57 A T 16: 49,763,804 I307F possibly damaging Het
Il22 A T 10: 118,205,810 R110W probably benign Het
Kcnk13 G T 12: 100,061,689 R341L probably damaging Het
Kif2b G A 11: 91,575,915 T514M probably damaging Het
Kmt2c A C 5: 25,310,517 I2776S probably damaging Het
Ly9 T C 1: 171,601,155 D189G probably benign Het
Mal2 T C 15: 54,588,357 V58A probably damaging Het
Mettl21e T A 1: 44,206,366 N240I probably benign Het
Muc5ac C T 7: 141,809,744 probably benign Het
Nacc1 G A 8: 84,673,215 R458C probably damaging Het
Ncapd3 T C 9: 27,030,809 C14R probably damaging Het
Obscn G T 11: 58,995,453 probably benign Het
Olfr273 A G 4: 52,855,695 F273L probably benign Het
Olfr350 A T 2: 36,850,222 M59L possibly damaging Het
Olfr930 T A 9: 38,930,476 F102I possibly damaging Het
Parp12 T C 6: 39,111,736 I189V probably benign Het
Pde4dip C A 3: 97,767,024 R192L possibly damaging Het
Pdlim4 C A 11: 54,055,848 E204D probably damaging Het
Phf3 T C 1: 30,813,982 Q1049R probably damaging Het
Psg25 C T 7: 18,521,398 V398I probably benign Het
Ptprq T A 10: 107,686,225 N622Y probably damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Tex36 A G 7: 133,587,273 L190P probably benign Het
Tk1 A G 11: 117,816,494 C156R probably damaging Het
Tmem144 T A 3: 79,832,099 M126L probably benign Het
Tmem208 G A 8: 105,328,230 probably null Het
Trappc13 T C 13: 104,150,152 Q199R probably damaging Het
Trim30b T A 7: 104,363,753 K156N probably damaging Het
Trps1 A G 15: 50,831,605 probably null Het
Washc4 T A 10: 83,558,893 F329Y possibly damaging Het
Zbed5 T G 5: 129,903,185 D658E probably benign Het
Zfyve28 T G 5: 34,288,105 K11N probably benign Het
Zp1 C T 19: 10,916,513 V443I possibly damaging Het
Other mutations in Prr14l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Prr14l APN 5 32830676 missense probably benign 0.04
IGL00331:Prr14l APN 5 32831066 missense probably benign 0.02
IGL01571:Prr14l APN 5 32828806 missense probably benign 0.01
IGL01795:Prr14l APN 5 32831845 unclassified probably benign
IGL01929:Prr14l APN 5 32828243 missense probably benign 0.09
IGL01959:Prr14l APN 5 32830205 missense possibly damaging 0.84
IGL02139:Prr14l APN 5 32827532 missense probably damaging 1.00
IGL02321:Prr14l APN 5 32827807 missense probably benign 0.10
IGL02508:Prr14l APN 5 32830942 missense probably benign 0.01
IGL02551:Prr14l APN 5 32831484 missense probably damaging 1.00
IGL02585:Prr14l APN 5 32829484 missense possibly damaging 0.59
IGL02614:Prr14l APN 5 32830543 missense possibly damaging 0.76
IGL02808:Prr14l APN 5 32828182 missense possibly damaging 0.94
IGL02836:Prr14l APN 5 32831096 missense probably benign 0.42
IGL02952:Prr14l APN 5 32835670 missense unknown
IGL03034:Prr14l APN 5 32827438 missense possibly damaging 0.48
H8562:Prr14l UTSW 5 32793728 missense probably damaging 1.00
R0086:Prr14l UTSW 5 32831559 unclassified probably benign
R0149:Prr14l UTSW 5 32793641 missense probably damaging 1.00
R0333:Prr14l UTSW 5 32827993 missense probably damaging 1.00
R0361:Prr14l UTSW 5 32793641 missense probably damaging 1.00
R0416:Prr14l UTSW 5 32828717 missense probably benign 0.25
R0480:Prr14l UTSW 5 32829880 missense probably benign 0.02
R0511:Prr14l UTSW 5 32844216 intron probably benign
R0639:Prr14l UTSW 5 32828915 missense probably benign 0.02
R0673:Prr14l UTSW 5 32828915 missense probably benign 0.02
R0743:Prr14l UTSW 5 32831194 missense possibly damaging 0.55
R0792:Prr14l UTSW 5 32828423 missense probably damaging 1.00
R1006:Prr14l UTSW 5 32829482 missense probably benign 0.00
R1342:Prr14l UTSW 5 32830260 missense probably damaging 1.00
R1433:Prr14l UTSW 5 32828833 missense probably damaging 1.00
R1527:Prr14l UTSW 5 32827949 missense possibly damaging 0.75
R1704:Prr14l UTSW 5 32830282 missense probably benign 0.01
R1967:Prr14l UTSW 5 32844469 intron probably benign
R2129:Prr14l UTSW 5 32831828 unclassified probably benign
R2150:Prr14l UTSW 5 32830702 missense probably benign 0.14
R2318:Prr14l UTSW 5 32830078 missense probably benign 0.04
R2915:Prr14l UTSW 5 32829768 missense probably benign 0.04
R3551:Prr14l UTSW 5 32828619 unclassified probably null
R3820:Prr14l UTSW 5 32828984 missense probably damaging 0.99
R3852:Prr14l UTSW 5 32830345 missense probably damaging 1.00
R4126:Prr14l UTSW 5 32828003 missense probably damaging 0.97
R4345:Prr14l UTSW 5 32828576 missense probably damaging 1.00
R4388:Prr14l UTSW 5 32829254 missense probably damaging 1.00
R4575:Prr14l UTSW 5 32793644 missense probably damaging 1.00
R4596:Prr14l UTSW 5 32829308 missense probably benign 0.01
R4690:Prr14l UTSW 5 32844156 intron probably benign
R4824:Prr14l UTSW 5 32844399 intron probably benign
R4868:Prr14l UTSW 5 32829937 missense probably benign 0.04
R4869:Prr14l UTSW 5 32828833 missense probably damaging 1.00
R5201:Prr14l UTSW 5 32830247 missense possibly damaging 0.52
R5328:Prr14l UTSW 5 32830021 missense probably benign 0.00
R5410:Prr14l UTSW 5 32827777 missense probably damaging 0.98
R5476:Prr14l UTSW 5 32844138 intron probably benign
R5623:Prr14l UTSW 5 32844508 intron probably benign
R5730:Prr14l UTSW 5 32793603 missense probably damaging 1.00
R5988:Prr14l UTSW 5 32830851 missense probably damaging 0.98
R6261:Prr14l UTSW 5 32829404 missense possibly damaging 0.46
R6283:Prr14l UTSW 5 32830264 missense probably benign 0.14
R6307:Prr14l UTSW 5 32827525 missense probably damaging 0.97
R6825:Prr14l UTSW 5 32828548 missense possibly damaging 0.86
R6880:Prr14l UTSW 5 32830867 missense probably benign 0.01
R6931:Prr14l UTSW 5 32830691 missense probably damaging 0.98
R7101:Prr14l UTSW 5 32829427 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGTGATGGCATCTTGTTGC -3'
(R):5'- AACCTGAAACCGTAGCTAGCG -3'

Sequencing Primer
(F):5'- GATGGCATCTTGTTGCTCAAATC -3'
(R):5'- ACCGTAGCTAGCGAGAACTTGC -3'
Posted On2018-10-18