Incidental Mutation 'R6862:Nacc1'
ID535700
Institutional Source Beutler Lab
Gene Symbol Nacc1
Ensembl Gene ENSMUSG00000001910
Gene Namenucleus accumbens associated 1, BEN and BTB (POZ) domain containing
SynonymsBtbd14b, 2010001H03Rik, 4930511N13Rik, Nac1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6862 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location84670483-84687862 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 84673215 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 458 (R458C)
Ref Sequence ENSEMBL: ENSMUSP00000001975 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001975]
Predicted Effect probably damaging
Transcript: ENSMUST00000001975
AA Change: R458C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001975
Gene: ENSMUSG00000001910
AA Change: R458C

DomainStartEndE-ValueType
BTB 30 124 4.05e-25 SMART
low complexity region 135 146 N/A INTRINSIC
low complexity region 224 235 N/A INTRINSIC
low complexity region 252 264 N/A INTRINSIC
low complexity region 267 281 N/A INTRINSIC
BEN 382 457 6.4e-18 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the BTB/POZ protein family. BTB/POZ proteins are involved in several cellular processes including proliferation, apoptosis and transcription regulation. The encoded protein is a transcriptional repressor that plays a role in stem cell self-renewal and pluripotency maintenance. The encoded protein also suppresses transcription of the candidate tumor suppressor Gadd45GIP1, and expression of this gene may play a role in the progression of multiple types of cancer. A pseudogene of this gene is located on the short arm of chromosome 9. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased sensitivity to cocaine and amphetamine. Mice homozygous for a different knock-out allele exhibit thoracic vertebral transformation and loss of the sixth lumbar vertebrae with decreaed rib number and reduced chondrocyte migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik C T 3: 138,186,188 probably benign Het
Adgra2 C A 8: 27,113,436 H416Q probably benign Het
Adgra2 T A 8: 27,113,437 C417S probably damaging Het
Aff3 C A 1: 38,406,497 R307L possibly damaging Het
Arhgap17 T C 7: 123,321,901 D121G probably damaging Het
Ascc3 G T 10: 50,849,646 R2155I probably null Het
Ccdc115 C T 1: 34,439,283 S19N possibly damaging Het
Ccser2 T C 14: 36,940,081 N382S probably benign Het
Cct6b A T 11: 82,719,959 V500E probably damaging Het
Cenpo A T 12: 4,216,539 Y190N probably damaging Het
Cfh T A 1: 140,102,362 K924N probably damaging Het
Col4a1 A G 8: 11,202,926 probably benign Het
Coro1b T C 19: 4,150,771 V234A probably benign Het
Crot T C 5: 8,989,641 K69E probably damaging Het
Cyp2d11 A T 15: 82,390,138 H347Q probably benign Het
Fam71b G A 11: 46,407,591 G574D possibly damaging Het
Fbn2 T A 18: 58,124,321 I325F probably benign Het
Fbxw4 T A 19: 45,582,748 R41S probably benign Het
Fn1 T A 1: 71,613,907 I1308F probably benign Het
Frem1 C A 4: 83,012,014 E232* probably null Het
Gabrg3 T C 7: 56,773,311 Q213R possibly damaging Het
Gm11639 A T 11: 104,721,458 K636* probably null Het
Gm428 A G 4: 73,687,384 N344S probably benign Het
Gsdme A T 6: 50,227,398 V193E probably damaging Het
Hadha C A 5: 30,147,979 probably null Het
Hdgfl2 C A 17: 56,099,211 A533E probably damaging Het
Hivep2 T C 10: 14,130,583 F975S probably damaging Het
Htatip2 T A 7: 49,770,918 S171T probably benign Het
Ift57 A T 16: 49,763,804 I307F possibly damaging Het
Il22 A T 10: 118,205,810 R110W probably benign Het
Kcnk13 G T 12: 100,061,689 R341L probably damaging Het
Kif2b G A 11: 91,575,915 T514M probably damaging Het
Kmt2c A C 5: 25,310,517 I2776S probably damaging Het
Ly9 T C 1: 171,601,155 D189G probably benign Het
Mal2 T C 15: 54,588,357 V58A probably damaging Het
Mettl21e T A 1: 44,206,366 N240I probably benign Het
Muc5ac C T 7: 141,809,744 probably benign Het
Ncapd3 T C 9: 27,030,809 C14R probably damaging Het
Obscn G T 11: 58,995,453 probably benign Het
Olfr273 A G 4: 52,855,695 F273L probably benign Het
Olfr350 A T 2: 36,850,222 M59L possibly damaging Het
Olfr930 T A 9: 38,930,476 F102I possibly damaging Het
Parp12 T C 6: 39,111,736 I189V probably benign Het
Pde4dip C A 3: 97,767,024 R192L possibly damaging Het
Pdlim4 C A 11: 54,055,848 E204D probably damaging Het
Phf3 T C 1: 30,813,982 Q1049R probably damaging Het
Prr14l A G 5: 32,827,759 L1464P probably damaging Het
Psg25 C T 7: 18,521,398 V398I probably benign Het
Ptprq T A 10: 107,686,225 N622Y probably damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Tex36 A G 7: 133,587,273 L190P probably benign Het
Tk1 A G 11: 117,816,494 C156R probably damaging Het
Tmem144 T A 3: 79,832,099 M126L probably benign Het
Tmem208 G A 8: 105,328,230 probably null Het
Trappc13 T C 13: 104,150,152 Q199R probably damaging Het
Trim30b T A 7: 104,363,753 K156N probably damaging Het
Trps1 A G 15: 50,831,605 probably null Het
Washc4 T A 10: 83,558,893 F329Y possibly damaging Het
Zbed5 T G 5: 129,903,185 D658E probably benign Het
Zfyve28 T G 5: 34,288,105 K11N probably benign Het
Zp1 C T 19: 10,916,513 V443I possibly damaging Het
Other mutations in Nacc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0052:Nacc1 UTSW 8 84676225 missense probably benign 0.00
R0069:Nacc1 UTSW 8 84677199 missense probably damaging 1.00
R0145:Nacc1 UTSW 8 84674875 splice site probably benign
R0732:Nacc1 UTSW 8 84676201 missense probably damaging 0.96
R1966:Nacc1 UTSW 8 84676381 missense probably damaging 1.00
R2064:Nacc1 UTSW 8 84673118 missense probably benign 0.18
R3709:Nacc1 UTSW 8 84677199 missense probably damaging 1.00
R4409:Nacc1 UTSW 8 84673044 makesense probably null
R5428:Nacc1 UTSW 8 84676154 missense probably damaging 1.00
R6014:Nacc1 UTSW 8 84675071 missense possibly damaging 0.93
R6341:Nacc1 UTSW 8 84674791 missense probably benign 0.09
R7288:Nacc1 UTSW 8 84676545 missense probably benign
Z1088:Nacc1 UTSW 8 84673286 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGAGAACCTCAGCTGAAGG -3'
(R):5'- TAGCACCACATTTTCTTTAGGGG -3'

Sequencing Primer
(F):5'- AACCTCAGCTGAAGGGCCAG -3'
(R):5'- CCAGGTGAGCAGCAGTAGTTTG -3'
Posted On2018-10-18