Incidental Mutation 'R6863:D1Ertd622e'
ID535729
Institutional Source Beutler Lab
Gene Symbol D1Ertd622e
Ensembl Gene ENSMUSG00000044768
Gene NameDNA segment, Chr 1, ERATO Doi 622, expressed
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock #R6863 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location97606318-97662074 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 97646305 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 12 (T12A)
Ref Sequence ENSEMBL: ENSMUSP00000138031 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053033] [ENSMUST00000142234] [ENSMUST00000149927] [ENSMUST00000153115]
Predicted Effect probably benign
Transcript: ENSMUST00000053033
AA Change: T12A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000051034
Gene: ENSMUSG00000044768
AA Change: T12A

DomainStartEndE-ValueType
Pfam:UNC119_bdg 3 201 2.3e-119 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142234
AA Change: T12A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000137803
Gene: ENSMUSG00000044768
AA Change: T12A

DomainStartEndE-ValueType
Pfam:UNC119_bdg 3 134 1.1e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149927
AA Change: T12A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000121997
Gene: ENSMUSG00000044768
AA Change: T12A

DomainStartEndE-ValueType
Pfam:UNC119_bdg 3 201 8.7e-116 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153115
AA Change: T12A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000138031
Gene: ENSMUSG00000044768
AA Change: T12A

DomainStartEndE-ValueType
Pfam:UNC119_bdg 3 201 2.3e-119 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931428F04Rik T C 8: 105,285,803 D4G probably damaging Het
Adamts20 A T 15: 94,379,746 Y278* probably null Het
Agap3 A T 5: 24,452,463 Y86F possibly damaging Het
Agap3 C A 5: 24,452,464 Y86* probably null Het
Ahnak T C 19: 9,012,365 probably benign Het
Arhgap45 G T 10: 80,017,782 E43D probably benign Het
Cacna1d A C 14: 30,075,852 I1426S probably damaging Het
Cdkn2a T C 4: 89,274,766 E159G probably benign Het
Cep85l C A 10: 53,349,118 W125L probably damaging Het
Ces1g C T 8: 93,317,019 V431M possibly damaging Het
Csmd1 G A 8: 17,534,913 A21V possibly damaging Het
Ctsc T A 7: 88,302,278 Y243* probably null Het
Ctu1 A G 7: 43,676,622 E235G probably damaging Het
Degs2 T C 12: 108,702,202 Y14C probably damaging Het
Dnaaf5 T C 5: 139,151,596 F235L probably damaging Het
Dpp8 T C 9: 65,035,008 S5P probably damaging Het
Dync1h1 T C 12: 110,652,180 I3288T probably benign Het
Ebpl A T 14: 61,360,302 L30Q probably damaging Het
Etaa1 T A 11: 17,953,794 M1L probably benign Het
Etl4 A G 2: 20,806,309 T1068A probably benign Het
Eya1 C A 1: 14,270,975 probably null Het
Fam26e C A 10: 34,092,455 A201S probably benign Het
Fat1 G T 8: 45,044,464 V4329L probably damaging Het
Fras1 A T 5: 96,543,306 Q127L probably benign Het
Gm1110 T G 9: 26,881,064 Y590S probably damaging Het
Gm14410 G A 2: 177,194,067 Q135* probably null Het
Gm5039 T C 12: 88,321,198 Y95C probably damaging Het
Greb1 A T 12: 16,684,420 V1523D probably damaging Het
Hmg20b T C 10: 81,347,020 N210S probably damaging Het
Kcnh7 T C 2: 62,787,685 K487E possibly damaging Het
Kcnk13 G T 12: 100,061,689 R341L probably damaging Het
Kif17 T A 4: 138,269,884 Y139* probably null Het
Klhl2 A T 8: 64,823,091 N53K probably benign Het
Lrit2 G T 14: 37,071,944 G322C probably damaging Het
Mgam A T 6: 40,729,009 Q4L probably benign Het
Mst1r A G 9: 107,920,026 T1365A probably benign Het
Muc5ac C T 7: 141,809,744 probably benign Het
Mydgf C A 17: 56,183,789 V35L probably damaging Het
Nmt2 T A 2: 3,305,304 probably null Het
Olfr600 C T 7: 103,346,916 C4Y possibly damaging Het
Olfr982 A G 9: 40,074,814 Y173C probably damaging Het
Pik3r2 T C 8: 70,770,414 Y454C probably damaging Het
Rad54l T C 4: 116,099,669 Y485C probably damaging Het
Rapgef6 T A 11: 54,546,380 S50T probably benign Het
Scaf11 T C 15: 96,419,419 S755G probably damaging Het
Shb A G 4: 45,458,163 W135R probably damaging Het
Slc1a4 T C 11: 20,314,001 K239E probably damaging Het
Slc44a4 T A 17: 34,923,822 V248D probably benign Het
Smpdl3a T A 10: 57,808,011 Y288* probably null Het
Sptbn1 T C 11: 30,146,777 M267V possibly damaging Het
Taok2 C T 7: 126,871,937 R661Q probably damaging Het
Tas1r2 A T 4: 139,669,719 I819F probably damaging Het
Themis2 A T 4: 132,789,596 W198R probably damaging Het
Timd4 C G 11: 46,815,443 S24* probably null Het
Tnrc18 T C 5: 142,815,197 D2G probably damaging Het
Wdr35 A G 12: 8,990,047 D384G probably damaging Het
Zfp560 C A 9: 20,348,499 V356F probably damaging Het
Other mutations in D1Ertd622e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01486:D1Ertd622e APN 1 97646006 missense probably damaging 0.99
IGL02349:D1Ertd622e APN 1 97646052 missense probably damaging 1.00
R0577:D1Ertd622e UTSW 1 97661826 splice site probably null
R1646:D1Ertd622e UTSW 1 97645806 missense probably damaging 0.99
R3611:D1Ertd622e UTSW 1 97646334 missense probably damaging 1.00
R5270:D1Ertd622e UTSW 1 97645995 missense probably damaging 1.00
R5934:D1Ertd622e UTSW 1 97645930 missense possibly damaging 0.69
R7133:D1Ertd622e UTSW 1 97645920 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCAGGAGTTCCTCACCAGTG -3'
(R):5'- GCAGCGCTCATTTGTTACCTG -3'

Sequencing Primer
(F):5'- TGGTGAAGCCAACCAAGTAGTTAG -3'
(R):5'- ACCTGCTCTGATGTGTCTCATAG -3'
Posted On2018-10-18