Incidental Mutation 'R6863:Cdkn2a'
ID535735
Institutional Source Beutler Lab
Gene Symbol Cdkn2a
Ensembl Gene ENSMUSG00000044303
Gene Namecyclin dependent kinase inhibitor 2A
Synonymsp16, Ink4a/Arf, p19, MTS1, p19ARF, Pctr1, p16INK4a, ARF-INK4a, Arf, INK4a-ARF
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6863 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location89274471-89294653 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89274766 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 159 (E159G)
Ref Sequence ENSEMBL: ENSMUSP00000061847 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060501] [ENSMUST00000107131]
PDB Structure
[]
Predicted Effect probably benign
Transcript: ENSMUST00000060501
AA Change: E159G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000061847
Gene: ENSMUSG00000044303
AA Change: E159G

DomainStartEndE-ValueType
ANK 3 32 1.53e3 SMART
ANK 36 64 4.07e-1 SMART
ANK 69 98 4.44e2 SMART
ANK 102 131 1.01e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107131
SMART Domains Protein: ENSMUSP00000102748
Gene: ENSMUSG00000044303

DomainStartEndE-ValueType
Blast:ANK 1 21 2e-6 BLAST
ANK 26 55 2.8e0 SMART
ANK 59 88 6.3e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene generates several transcript variants which differ in their first exons. At least three alternatively spliced variants encoding distinct proteins have been reported, two of which encode structurally related isoforms known to function as inhibitors of CDK4 kinase. The remaining transcript includes an alternate first exon located 20 Kb upstream of the remainder of the gene; this transcript contains an alternate open reading frame (ARF) that specifies a protein which is structurally unrelated to the products of the other variants. This ARF product functions as a stabilizer of the tumor suppressor protein p53 as it can interact with, and sequester, the E3 ubiquitin-protein ligase MDM2, a protein responsible for the degradation of p53. In spite of the structural and functional differences, the CDK inhibitor isoforms and the ARF product encoded by this gene, through the regulatory roles of CDK4 and p53 in cell cycle G1 progression, share a common functionality in cell cycle G1 control. This gene is frequently mutated or deleted in a wide variety of tumors, and is known to be an important tumor suppressor gene. [provided by RefSeq, Sep 2012]
PHENOTYPE: Null mutants of p16INK4a or p19ARF proteins each show increased tumor susceptibility and sensitivity to carcinogens. Loss of both gives very early onset. p19ARF nulls also show thymic hyperplasia and the eye's hyaloid vascular system fails to regress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931428F04Rik T C 8: 105,285,803 D4G probably damaging Het
Adamts20 A T 15: 94,379,746 Y278* probably null Het
Agap3 A T 5: 24,452,463 Y86F possibly damaging Het
Agap3 C A 5: 24,452,464 Y86* probably null Het
Ahnak T C 19: 9,012,365 probably benign Het
Arhgap45 G T 10: 80,017,782 E43D probably benign Het
Cacna1d A C 14: 30,075,852 I1426S probably damaging Het
Cep85l C A 10: 53,349,118 W125L probably damaging Het
Ces1g C T 8: 93,317,019 V431M possibly damaging Het
Csmd1 G A 8: 17,534,913 A21V possibly damaging Het
Ctsc T A 7: 88,302,278 Y243* probably null Het
Ctu1 A G 7: 43,676,622 E235G probably damaging Het
D1Ertd622e T C 1: 97,646,305 T12A probably benign Het
Degs2 T C 12: 108,702,202 Y14C probably damaging Het
Dnaaf5 T C 5: 139,151,596 F235L probably damaging Het
Dpp8 T C 9: 65,035,008 S5P probably damaging Het
Dync1h1 T C 12: 110,652,180 I3288T probably benign Het
Ebpl A T 14: 61,360,302 L30Q probably damaging Het
Etaa1 T A 11: 17,953,794 M1L probably benign Het
Etl4 A G 2: 20,806,309 T1068A probably benign Het
Eya1 C A 1: 14,270,975 probably null Het
Fam26e C A 10: 34,092,455 A201S probably benign Het
Fat1 G T 8: 45,044,464 V4329L probably damaging Het
Fras1 A T 5: 96,543,306 Q127L probably benign Het
Gm1110 T G 9: 26,881,064 Y590S probably damaging Het
Gm14410 G A 2: 177,194,067 Q135* probably null Het
Gm5039 T C 12: 88,321,198 Y95C probably damaging Het
Greb1 A T 12: 16,684,420 V1523D probably damaging Het
Hmg20b T C 10: 81,347,020 N210S probably damaging Het
Kcnh7 T C 2: 62,787,685 K487E possibly damaging Het
Kcnk13 G T 12: 100,061,689 R341L probably damaging Het
Kif17 T A 4: 138,269,884 Y139* probably null Het
Klhl2 A T 8: 64,823,091 N53K probably benign Het
Lrit2 G T 14: 37,071,944 G322C probably damaging Het
Mgam A T 6: 40,729,009 Q4L probably benign Het
Mst1r A G 9: 107,920,026 T1365A probably benign Het
Muc5ac C T 7: 141,809,744 probably benign Het
Mydgf C A 17: 56,183,789 V35L probably damaging Het
Nmt2 T A 2: 3,305,304 probably null Het
Olfr600 C T 7: 103,346,916 C4Y possibly damaging Het
Olfr982 A G 9: 40,074,814 Y173C probably damaging Het
Pik3r2 T C 8: 70,770,414 Y454C probably damaging Het
Rad54l T C 4: 116,099,669 Y485C probably damaging Het
Rapgef6 T A 11: 54,546,380 S50T probably benign Het
Scaf11 T C 15: 96,419,419 S755G probably damaging Het
Shb A G 4: 45,458,163 W135R probably damaging Het
Slc1a4 T C 11: 20,314,001 K239E probably damaging Het
Slc44a4 T A 17: 34,923,822 V248D probably benign Het
Smpdl3a T A 10: 57,808,011 Y288* probably null Het
Sptbn1 T C 11: 30,146,777 M267V possibly damaging Het
Taok2 C T 7: 126,871,937 R661Q probably damaging Het
Tas1r2 A T 4: 139,669,719 I819F probably damaging Het
Themis2 A T 4: 132,789,596 W198R probably damaging Het
Timd4 C G 11: 46,815,443 S24* probably null Het
Tnrc18 T C 5: 142,815,197 D2G probably damaging Het
Wdr35 A G 12: 8,990,047 D384G probably damaging Het
Zfp560 C A 9: 20,348,499 V356F probably damaging Het
Other mutations in Cdkn2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01936:Cdkn2a APN 4 89294332 critical splice donor site probably null 0.00
R0158:Cdkn2a UTSW 4 89276767 missense possibly damaging 0.92
R2073:Cdkn2a UTSW 4 89294493 missense possibly damaging 0.71
R4787:Cdkn2a UTSW 4 89276718 missense unknown
R5679:Cdkn2a UTSW 4 89276861 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TTTGGGGACAGAGGAAAGCATTTC -3'
(R):5'- TCAGAGACTGGAGATGCTCAG -3'

Sequencing Primer
(F):5'- AACAATCCAGCCATTATTCCCTTCG -3'
(R):5'- GATGCTCAGAAGGCCACCTAG -3'
Posted On2018-10-18