Incidental Mutation 'R6863:Zfp560'
ID535757
Institutional Source Beutler Lab
Gene Symbol Zfp560
Ensembl Gene ENSMUSG00000045519
Gene Namezinc finger protein 560
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6863 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location20345136-20385177 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 20348499 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 356 (V356F)
Ref Sequence ENSEMBL: ENSMUSP00000065620 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068079] [ENSMUST00000143992]
Predicted Effect probably damaging
Transcript: ENSMUST00000068079
AA Change: V356F

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000065620
Gene: ENSMUSG00000045519
AA Change: V356F

DomainStartEndE-ValueType
KRAB 41 101 3.22e-27 SMART
low complexity region 147 158 N/A INTRINSIC
ZnF_C2H2 279 301 4.01e-5 SMART
ZnF_C2H2 307 329 9.58e-3 SMART
ZnF_C2H2 335 357 5.5e-3 SMART
ZnF_C2H2 363 385 9.58e-3 SMART
ZnF_C2H2 391 413 3.74e-5 SMART
ZnF_C2H2 419 441 2.43e-4 SMART
ZnF_C2H2 447 469 1.28e-3 SMART
ZnF_C2H2 475 497 1.06e-4 SMART
ZnF_C2H2 503 525 3.11e-2 SMART
ZnF_C2H2 531 553 8.47e-4 SMART
ZnF_C2H2 559 581 2.99e-4 SMART
ZnF_C2H2 587 609 4.24e-4 SMART
ZnF_C2H2 615 637 3.44e-4 SMART
ZnF_C2H2 643 665 1.26e-2 SMART
ZnF_C2H2 671 693 1.69e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143992
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931428F04Rik T C 8: 105,285,803 D4G probably damaging Het
Adamts20 A T 15: 94,379,746 Y278* probably null Het
Agap3 C A 5: 24,452,464 Y86* probably null Het
Agap3 A T 5: 24,452,463 Y86F possibly damaging Het
Ahnak T C 19: 9,012,365 probably benign Het
Arhgap45 G T 10: 80,017,782 E43D probably benign Het
Cacna1d A C 14: 30,075,852 I1426S probably damaging Het
Cdkn2a T C 4: 89,274,766 E159G probably benign Het
Cep85l C A 10: 53,349,118 W125L probably damaging Het
Ces1g C T 8: 93,317,019 V431M possibly damaging Het
Csmd1 G A 8: 17,534,913 A21V possibly damaging Het
Ctsc T A 7: 88,302,278 Y243* probably null Het
Ctu1 A G 7: 43,676,622 E235G probably damaging Het
D1Ertd622e T C 1: 97,646,305 T12A probably benign Het
Degs2 T C 12: 108,702,202 Y14C probably damaging Het
Dnaaf5 T C 5: 139,151,596 F235L probably damaging Het
Dpp8 T C 9: 65,035,008 S5P probably damaging Het
Dync1h1 T C 12: 110,652,180 I3288T probably benign Het
Ebpl A T 14: 61,360,302 L30Q probably damaging Het
Etaa1 T A 11: 17,953,794 M1L probably benign Het
Etl4 A G 2: 20,806,309 T1068A probably benign Het
Eya1 C A 1: 14,270,975 probably null Het
Fam26e C A 10: 34,092,455 A201S probably benign Het
Fat1 G T 8: 45,044,464 V4329L probably damaging Het
Fras1 A T 5: 96,543,306 Q127L probably benign Het
Gm1110 T G 9: 26,881,064 Y590S probably damaging Het
Gm14410 G A 2: 177,194,067 Q135* probably null Het
Gm5039 T C 12: 88,321,198 Y95C probably damaging Het
Greb1 A T 12: 16,684,420 V1523D probably damaging Het
Hmg20b T C 10: 81,347,020 N210S probably damaging Het
Kcnh7 T C 2: 62,787,685 K487E possibly damaging Het
Kcnk13 G T 12: 100,061,689 R341L probably damaging Het
Kif17 T A 4: 138,269,884 Y139* probably null Het
Klhl2 A T 8: 64,823,091 N53K probably benign Het
Lrit2 G T 14: 37,071,944 G322C probably damaging Het
Mgam A T 6: 40,729,009 Q4L probably benign Het
Mst1r A G 9: 107,920,026 T1365A probably benign Het
Muc5ac C T 7: 141,809,744 probably benign Het
Mydgf C A 17: 56,183,789 V35L probably damaging Het
Nmt2 T A 2: 3,305,304 probably null Het
Olfr600 C T 7: 103,346,916 C4Y possibly damaging Het
Olfr982 A G 9: 40,074,814 Y173C probably damaging Het
Pik3r2 T C 8: 70,770,414 Y454C probably damaging Het
Rad54l T C 4: 116,099,669 Y485C probably damaging Het
Rapgef6 T A 11: 54,546,380 S50T probably benign Het
Scaf11 T C 15: 96,419,419 S755G probably damaging Het
Shb A G 4: 45,458,163 W135R probably damaging Het
Slc1a4 T C 11: 20,314,001 K239E probably damaging Het
Slc44a4 T A 17: 34,923,822 V248D probably benign Het
Smpdl3a T A 10: 57,808,011 Y288* probably null Het
Sptbn1 T C 11: 30,146,777 M267V possibly damaging Het
Taok2 C T 7: 126,871,937 R661Q probably damaging Het
Tas1r2 A T 4: 139,669,719 I819F probably damaging Het
Themis2 A T 4: 132,789,596 W198R probably damaging Het
Timd4 C G 11: 46,815,443 S24* probably null Het
Tnrc18 T C 5: 142,815,197 D2G probably damaging Het
Wdr35 A G 12: 8,990,047 D384G probably damaging Het
Other mutations in Zfp560
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00933:Zfp560 APN 9 20348808 missense probably benign 0.00
IGL02400:Zfp560 APN 9 20350600 missense possibly damaging 0.73
R0002:Zfp560 UTSW 9 20347517 missense probably damaging 1.00
R0004:Zfp560 UTSW 9 20347967 missense probably damaging 1.00
R0019:Zfp560 UTSW 9 20348360 missense probably benign 0.23
R1401:Zfp560 UTSW 9 20351853 missense possibly damaging 0.71
R1481:Zfp560 UTSW 9 20348790 missense probably benign
R1521:Zfp560 UTSW 9 20348775 unclassified probably null
R1569:Zfp560 UTSW 9 20348715 missense possibly damaging 0.83
R1579:Zfp560 UTSW 9 20347991 missense possibly damaging 0.73
R1673:Zfp560 UTSW 9 20347653 missense probably benign 0.37
R1694:Zfp560 UTSW 9 20347986 nonsense probably null
R1796:Zfp560 UTSW 9 20351930 missense possibly damaging 0.71
R2971:Zfp560 UTSW 9 20348944 missense probably benign 0.00
R3416:Zfp560 UTSW 9 20347678 nonsense probably null
R4182:Zfp560 UTSW 9 20347448 missense probably benign 0.11
R4509:Zfp560 UTSW 9 20348723 missense probably damaging 1.00
R4708:Zfp560 UTSW 9 20351918 missense possibly damaging 0.85
R4735:Zfp560 UTSW 9 20349051 missense probably benign 0.01
R4937:Zfp560 UTSW 9 20347967 missense probably damaging 1.00
R5562:Zfp560 UTSW 9 20350587 nonsense probably null
R6597:Zfp560 UTSW 9 20348001 missense probably benign 0.00
R6852:Zfp560 UTSW 9 20348043 missense probably damaging 0.99
R7267:Zfp560 UTSW 9 20348088 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGACACTCGAAGGGCTTCTC -3'
(R):5'- TTTTAGTCCAGCCTTGAGTCATG -3'

Sequencing Primer
(F):5'- CAGTGATCACATTCAAAGGGTCTCTC -3'
(R):5'- CAGCCTTGAGTCATGCTGAGAG -3'
Posted On2018-10-18