Incidental Mutation 'R6863:Kcnk13'
ID535775
Institutional Source Beutler Lab
Gene Symbol Kcnk13
Ensembl Gene ENSMUSG00000045404
Gene Namepotassium channel, subfamily K, member 13
SynonymsLOC381712, F730021E22Rik, LOC380778
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6863 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location99964499-100062682 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 100061689 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 341 (R341L)
Ref Sequence ENSEMBL: ENSMUSP00000136882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049788] [ENSMUST00000160413] [ENSMUST00000177549]
Predicted Effect probably damaging
Transcript: ENSMUST00000049788
AA Change: R341L

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000051846
Gene: ENSMUSG00000045404
AA Change: R341L

DomainStartEndE-ValueType
low complexity region 21 36 N/A INTRINSIC
Pfam:Ion_trans_2 75 151 4.7e-18 PFAM
Pfam:Ion_trans_2 195 285 3.3e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000160413
AA Change: R341L

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000123916
Gene: ENSMUSG00000045404
AA Change: R341L

DomainStartEndE-ValueType
low complexity region 21 36 N/A INTRINSIC
Pfam:Ion_trans_2 74 151 6e-17 PFAM
Pfam:Ion_trans_2 195 285 7.9e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000177549
AA Change: R341L

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000136882
Gene: ENSMUSG00000045404
AA Change: R341L

DomainStartEndE-ValueType
low complexity region 21 36 N/A INTRINSIC
Pfam:Ion_trans_2 75 151 4.7e-18 PFAM
Pfam:Ion_trans_2 195 285 3.3e-18 PFAM
Meta Mutation Damage Score 0.324 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Potassium channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a potassium channel containing two pore-forming domains. This protein is an open channel that can be stimulated by arachidonic acid and inhibited by the anesthetic halothane. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous knockout reduces the surveillance activity of microglial cells in the brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931428F04Rik T C 8: 105,285,803 D4G probably damaging Het
Adamts20 A T 15: 94,379,746 Y278* probably null Het
Agap3 A T 5: 24,452,463 Y86F possibly damaging Het
Agap3 C A 5: 24,452,464 Y86* probably null Het
Ahnak T C 19: 9,012,365 probably benign Het
Arhgap45 G T 10: 80,017,782 E43D probably benign Het
Cacna1d A C 14: 30,075,852 I1426S probably damaging Het
Cdkn2a T C 4: 89,274,766 E159G probably benign Het
Cep85l C A 10: 53,349,118 W125L probably damaging Het
Ces1g C T 8: 93,317,019 V431M possibly damaging Het
Csmd1 G A 8: 17,534,913 A21V possibly damaging Het
Ctsc T A 7: 88,302,278 Y243* probably null Het
Ctu1 A G 7: 43,676,622 E235G probably damaging Het
D1Ertd622e T C 1: 97,646,305 T12A probably benign Het
Degs2 T C 12: 108,702,202 Y14C probably damaging Het
Dnaaf5 T C 5: 139,151,596 F235L probably damaging Het
Dpp8 T C 9: 65,035,008 S5P probably damaging Het
Dync1h1 T C 12: 110,652,180 I3288T probably benign Het
Ebpl A T 14: 61,360,302 L30Q probably damaging Het
Etaa1 T A 11: 17,953,794 M1L probably benign Het
Etl4 A G 2: 20,806,309 T1068A probably benign Het
Eya1 C A 1: 14,270,975 probably null Het
Fam26e C A 10: 34,092,455 A201S probably benign Het
Fat1 G T 8: 45,044,464 V4329L probably damaging Het
Fras1 A T 5: 96,543,306 Q127L probably benign Het
Gm1110 T G 9: 26,881,064 Y590S probably damaging Het
Gm14410 G A 2: 177,194,067 Q135* probably null Het
Gm5039 T C 12: 88,321,198 Y95C probably damaging Het
Greb1 A T 12: 16,684,420 V1523D probably damaging Het
Hmg20b T C 10: 81,347,020 N210S probably damaging Het
Kcnh7 T C 2: 62,787,685 K487E possibly damaging Het
Kif17 T A 4: 138,269,884 Y139* probably null Het
Klhl2 A T 8: 64,823,091 N53K probably benign Het
Lrit2 G T 14: 37,071,944 G322C probably damaging Het
Mgam A T 6: 40,729,009 Q4L probably benign Het
Mst1r A G 9: 107,920,026 T1365A probably benign Het
Muc5ac C T 7: 141,809,744 probably benign Het
Mydgf C A 17: 56,183,789 V35L probably damaging Het
Nmt2 T A 2: 3,305,304 probably null Het
Olfr600 C T 7: 103,346,916 C4Y possibly damaging Het
Olfr982 A G 9: 40,074,814 Y173C probably damaging Het
Pik3r2 T C 8: 70,770,414 Y454C probably damaging Het
Rad54l T C 4: 116,099,669 Y485C probably damaging Het
Rapgef6 T A 11: 54,546,380 S50T probably benign Het
Scaf11 T C 15: 96,419,419 S755G probably damaging Het
Shb A G 4: 45,458,163 W135R probably damaging Het
Slc1a4 T C 11: 20,314,001 K239E probably damaging Het
Slc44a4 T A 17: 34,923,822 V248D probably benign Het
Smpdl3a T A 10: 57,808,011 Y288* probably null Het
Sptbn1 T C 11: 30,146,777 M267V possibly damaging Het
Taok2 C T 7: 126,871,937 R661Q probably damaging Het
Tas1r2 A T 4: 139,669,719 I819F probably damaging Het
Themis2 A T 4: 132,789,596 W198R probably damaging Het
Timd4 C G 11: 46,815,443 S24* probably null Het
Tnrc18 T C 5: 142,815,197 D2G probably damaging Het
Wdr35 A G 12: 8,990,047 D384G probably damaging Het
Zfp560 C A 9: 20,348,499 V356F probably damaging Het
Other mutations in Kcnk13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01394:Kcnk13 APN 12 100061662 missense probably benign 0.06
IGL01829:Kcnk13 APN 12 100060998 splice site probably benign
IGL01940:Kcnk13 APN 12 100061424 missense probably benign 0.01
IGL02549:Kcnk13 APN 12 100061751 nonsense probably null
IGL03105:Kcnk13 APN 12 100061110 missense probably damaging 1.00
R4730:Kcnk13 UTSW 12 100061715 missense probably damaging 0.98
R4851:Kcnk13 UTSW 12 99966124 missense probably damaging 0.98
R5284:Kcnk13 UTSW 12 100061289 missense probably benign 0.01
R5411:Kcnk13 UTSW 12 100061251 missense probably damaging 1.00
R6254:Kcnk13 UTSW 12 99965372 start gained probably benign
R6836:Kcnk13 UTSW 12 100061689 missense probably damaging 0.98
R6862:Kcnk13 UTSW 12 100061689 missense probably damaging 0.98
R6897:Kcnk13 UTSW 12 100061767 missense probably benign 0.11
R7211:Kcnk13 UTSW 12 100061817 missense probably damaging 0.96
R7438:Kcnk13 UTSW 12 100061726 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACAGACTGTGAACTGGATCCTG -3'
(R):5'- ACCAGTGGTGTAACAGTGTC -3'

Sequencing Primer
(F):5'- CTGTGAACTGGATCCTGAGGAAAC -3'
(R):5'- ACCAGTGGTGTAACAGTGTCTTATTC -3'
Posted On2018-10-18