Incidental Mutation 'R6864:Oxr1'
ID535833
Institutional Source Beutler Lab
Gene Symbol Oxr1
Ensembl Gene ENSMUSG00000022307
Gene Nameoxidation resistance 1
SynonymsC7B, 2210416C20Rik, C7
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6864 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location41447482-41861048 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 41823387 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 555 (V555G)
Ref Sequence ENSEMBL: ENSMUSP00000155237 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022918] [ENSMUST00000090095] [ENSMUST00000090096] [ENSMUST00000110297] [ENSMUST00000170127] [ENSMUST00000179393] [ENSMUST00000229511] [ENSMUST00000229769] [ENSMUST00000230203] [ENSMUST00000230778]
Predicted Effect probably damaging
Transcript: ENSMUST00000022918
AA Change: V467G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022918
Gene: ENSMUSG00000022307
AA Change: V467G

DomainStartEndE-ValueType
LysM 11 54 2.48e-9 SMART
low complexity region 113 120 N/A INTRINSIC
low complexity region 540 557 N/A INTRINSIC
TLDc 616 778 1.05e-80 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000090095
AA Change: V467G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000087553
Gene: ENSMUSG00000022307
AA Change: V467G

DomainStartEndE-ValueType
LysM 11 54 2.48e-9 SMART
low complexity region 113 120 N/A INTRINSIC
low complexity region 540 557 N/A INTRINSIC
TLDc 589 751 1.05e-80 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000090096
AA Change: V467G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000087554
Gene: ENSMUSG00000022307
AA Change: V467G

DomainStartEndE-ValueType
LysM 11 54 2.48e-9 SMART
low complexity region 113 120 N/A INTRINSIC
low complexity region 540 557 N/A INTRINSIC
TLDc 589 751 1.05e-80 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110297
AA Change: V555G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105926
Gene: ENSMUSG00000022307
AA Change: V555G

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
LysM 99 142 2.48e-9 SMART
low complexity region 201 208 N/A INTRINSIC
low complexity region 628 645 N/A INTRINSIC
TLDc 704 866 1.05e-80 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000170127
AA Change: V548G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126266
Gene: ENSMUSG00000022307
AA Change: V548G

DomainStartEndE-ValueType
LysM 92 135 2.48e-9 SMART
low complexity region 194 201 N/A INTRINSIC
low complexity region 621 638 N/A INTRINSIC
TLDc 670 832 1.05e-80 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000179393
AA Change: V467G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136923
Gene: ENSMUSG00000022307
AA Change: V467G

DomainStartEndE-ValueType
LysM 11 54 2.48e-9 SMART
low complexity region 113 120 N/A INTRINSIC
low complexity region 540 557 N/A INTRINSIC
TLDc 589 751 1.05e-80 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000229511
Predicted Effect probably benign
Transcript: ENSMUST00000229769
Predicted Effect probably damaging
Transcript: ENSMUST00000230203
AA Change: V555G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect possibly damaging
Transcript: ENSMUST00000230778
AA Change: V467G

PolyPhen 2 Score 0.766 (Sensitivity: 0.85; Specificity: 0.92)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency 100% (60/60)
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in progressive cerebellar neurodegeneration and ataxia, increased apoptosis in the cerebellar granule cell layer, and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre1 C T 17: 57,478,879 T875I probably damaging Het
Anln A T 9: 22,382,249 S33T probably benign Het
Anxa6 T C 11: 54,986,185 T541A probably benign Het
Atxn2 C T 5: 121,779,494 R334W probably damaging Het
AU040320 T A 4: 126,847,819 V940D probably damaging Het
Bcl2 A T 1: 106,543,281 Y232N probably damaging Het
Bmp7 A G 2: 172,940,062 V3A probably benign Het
Calr A T 8: 84,844,928 H145Q probably damaging Het
Camta2 T A 11: 70,671,966 T976S probably benign Het
Ccnk G A 12: 108,202,214 probably benign Het
Cntln T C 4: 85,096,792 S1107P probably damaging Het
Cradd T C 10: 95,175,927 D117G probably damaging Het
Dcaf7 C T 11: 106,046,821 T90I probably damaging Het
Defb30 T A 14: 63,036,103 probably null Het
Dock4 T A 12: 40,745,746 I854N probably damaging Het
Dym T A 18: 75,056,738 Y132* probably null Het
Eef1a2 T C 2: 181,149,684 T341A probably benign Het
Eml2 T C 7: 19,196,281 V309A probably damaging Het
Fam208a T A 14: 27,461,158 F525I probably damaging Het
Flnb C T 14: 7,905,640 P1130L possibly damaging Het
Hivep3 C A 4: 120,094,888 Q134K possibly damaging Het
Kbtbd2 T A 6: 56,780,026 K242* probably null Het
Kel A G 6: 41,703,760 probably null Het
Lcorl T A 5: 45,747,204 K177N probably damaging Het
Mbd3l2 A G 9: 18,443,499 probably benign Het
Mcm3ap A G 10: 76,507,479 D1735G probably damaging Het
Ms4a1 C A 19: 11,253,178 probably null Het
Muc5ac C T 7: 141,809,744 probably benign Het
Mylk C A 16: 34,874,150 P193Q probably benign Het
Olfr1275 C T 2: 111,231,197 V199I probably benign Het
Olfr1388 G T 11: 49,443,940 A30S probably benign Het
Olfr1390 A T 11: 49,340,753 T74S probably damaging Het
Olfr1424 A T 19: 12,059,413 F113Y probably damaging Het
Olfr339 T A 2: 36,421,820 C141S probably damaging Het
Otogl C T 10: 107,827,806 S968N probably damaging Het
Parp12 T C 6: 39,111,736 I189V probably benign Het
Peg3 T C 7: 6,712,762 Y103C probably damaging Het
Plekhh2 T C 17: 84,617,999 V1408A probably benign Het
Prkacb T C 3: 146,745,378 Y204C probably damaging Het
Prkch A G 12: 73,759,617 E546G probably damaging Het
Prss12 C A 3: 123,447,384 H76N probably benign Het
Rai14 G T 15: 10,633,168 S45R possibly damaging Het
Samd9l T A 6: 3,374,750 D837V probably benign Het
Slc22a6 G T 19: 8,618,441 C49F probably damaging Het
Slc2a2 T A 3: 28,721,725 I328N probably damaging Het
Slc35f4 T C 14: 49,318,853 I148V possibly damaging Het
Stk32b A T 5: 37,448,805 probably null Het
Tktl2 T C 8: 66,512,339 I183T probably damaging Het
Tmem175 A C 5: 108,645,979 H325P probably damaging Het
Tns3 A G 11: 8,493,196 V389A probably damaging Het
Trappc9 A T 15: 72,937,162 probably null Het
Trim28 T A 7: 13,029,458 F509I possibly damaging Het
Vmn1r210 T A 13: 22,827,543 Q191L probably benign Het
Vmn2r24 A T 6: 123,779,158 D63V possibly damaging Het
Zfp536 A G 7: 37,568,515 L492P probably damaging Het
Zfp831 C A 2: 174,646,740 N1069K possibly damaging Het
Zfp943 T A 17: 21,992,612 H226Q probably damaging Het
Other mutations in Oxr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00913:Oxr1 APN 15 41820143 missense possibly damaging 0.46
IGL02243:Oxr1 APN 15 41535701 utr 5 prime probably benign
IGL02711:Oxr1 APN 15 41653671 splice site probably benign
IGL02810:Oxr1 APN 15 41813583 missense probably benign 0.26
IGL02850:Oxr1 APN 15 41854933 missense probably damaging 1.00
IGL03028:Oxr1 APN 15 41817163 missense probably damaging 1.00
IGL03126:Oxr1 APN 15 41820249 missense possibly damaging 0.66
PIT4378001:Oxr1 UTSW 15 41801582 missense probably benign 0.01
R0004:Oxr1 UTSW 15 41820540 missense possibly damaging 0.64
R0276:Oxr1 UTSW 15 41820062 missense probably damaging 1.00
R0394:Oxr1 UTSW 15 41817197 missense probably damaging 1.00
R1513:Oxr1 UTSW 15 41797474 missense probably damaging 1.00
R1742:Oxr1 UTSW 15 41850559 missense probably damaging 1.00
R2145:Oxr1 UTSW 15 41819944 missense probably damaging 1.00
R2924:Oxr1 UTSW 15 41825957 missense probably benign 0.01
R3732:Oxr1 UTSW 15 41848701 missense probably damaging 1.00
R4537:Oxr1 UTSW 15 41820519 missense possibly damaging 0.67
R4722:Oxr1 UTSW 15 41813649 missense probably damaging 1.00
R4935:Oxr1 UTSW 15 41813584 missense probably benign 0.00
R5417:Oxr1 UTSW 15 41820371 missense probably benign 0.00
R6029:Oxr1 UTSW 15 41825901 missense probably damaging 1.00
R6187:Oxr1 UTSW 15 41825919 missense probably damaging 1.00
R6950:Oxr1 UTSW 15 41820555 missense probably benign 0.00
R7225:Oxr1 UTSW 15 41813608 missense not run
R7288:Oxr1 UTSW 15 41813608 missense not run
R7305:Oxr1 UTSW 15 41813608 missense not run
X0025:Oxr1 UTSW 15 41820452 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGTGAGGCAGTTAAATGAATATGC -3'
(R):5'- ATTTACCGAGAGCCCTGCTAC -3'

Sequencing Primer
(F):5'- ATGAATATGCACAAGTACCAGTAAG -3'
(R):5'- GGTCACCTTGAACTCACTGTGAATG -3'
Posted On2018-10-18