Incidental Mutation 'R6865:Cop1'
ID535844
Institutional Source Beutler Lab
Gene Symbol Cop1
Ensembl Gene ENSMUSG00000040782
Gene NameCOP1, E3 ubiquitin ligase
SynonymsCop1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.623) question?
Stock #R6865 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location159232320-159347640 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 159308954 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 536 (D536E)
Ref Sequence ENSEMBL: ENSMUSP00000076160 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076894] [ENSMUST00000195044]
Predicted Effect probably damaging
Transcript: ENSMUST00000076894
AA Change: D536E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000076160
Gene: ENSMUSG00000040782
AA Change: D536E

DomainStartEndE-ValueType
low complexity region 2 87 N/A INTRINSIC
low complexity region 98 112 N/A INTRINSIC
RING 138 175 3.69e-8 SMART
coiled coil region 235 305 N/A INTRINSIC
WD40 412 451 1.72e0 SMART
WD40 462 501 3.4e-2 SMART
WD40 504 544 3.42e-7 SMART
WD40 547 586 6.79e-2 SMART
WD40 590 628 1.9e-5 SMART
WD40 631 670 4.46e-1 SMART
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000192762
Predicted Effect probably benign
Transcript: ENSMUST00000195044
SMART Domains Protein: ENSMUSP00000141200
Gene: ENSMUSG00000040782

DomainStartEndE-ValueType
WD40 112 151 1.1e-2 SMART
WD40 162 201 2.1e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a conditional allele activated in prostate epithelial cells exhibit prostate gland hyperplasia and prostate intraepithelial neoplasia due to increased cell proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c12 T A 13: 4,270,213 M293L possibly damaging Het
Ankrd11 T C 8: 122,894,944 D723G probably benign Het
Ankrd26 T C 6: 118,523,481 R1010G possibly damaging Het
Apob G A 12: 8,008,847 R2410H probably benign Het
Auh T C 13: 52,838,129 D275G probably damaging Het
Card10 G T 15: 78,802,622 D47E possibly damaging Het
Ccdc141 C T 2: 77,029,235 probably null Het
Cfap206 T C 4: 34,714,448 Y416C possibly damaging Het
Chuk A T 19: 44,086,915 Y500* probably null Het
Crh G C 3: 19,694,140 P113A possibly damaging Het
Ddx54 T G 5: 120,621,827 probably null Het
Efcab7 T C 4: 99,912,596 S127P probably damaging Het
Efhc1 A G 1: 20,960,218 Y125C probably damaging Het
Fga T A 3: 83,031,541 C408S probably damaging Het
Flot2 T C 11: 78,049,492 S22P probably benign Het
Fndc1 T A 17: 7,772,840 T675S unknown Het
Foxc1 A G 13: 31,808,853 D549G unknown Het
Gldc T C 19: 30,133,762 N538S possibly damaging Het
Grk4 T G 5: 34,731,550 V346G probably damaging Het
Gucy2c T C 6: 136,770,129 R111G probably benign Het
Heatr6 C T 11: 83,769,140 H504Y probably damaging Het
Lrp5 A T 19: 3,620,013 probably null Het
Msrb1 T C 17: 24,736,711 S2P possibly damaging Het
Muc5ac C T 7: 141,809,744 probably benign Het
Myo3a A G 2: 22,574,301 I185V probably benign Het
Myo5c T C 9: 75,269,596 S608P probably benign Het
Nek6 A G 2: 38,569,666 I174V probably benign Het
Nmt2 T C 2: 3,314,729 V252A probably damaging Het
Nudt9 G T 5: 104,059,679 R179M probably damaging Het
Nwd1 T C 8: 72,657,062 V29A possibly damaging Het
Olah T C 2: 3,342,927 D216G possibly damaging Het
Olfr156 T C 4: 43,821,346 N5S probably benign Het
Olfr666 T C 7: 104,893,512 I39V probably benign Het
Parp12 T C 6: 39,111,736 I189V probably benign Het
Pkd1 T C 17: 24,576,487 V2318A probably benign Het
Pknox1 T A 17: 31,588,560 M51K probably damaging Het
Ppp1r12a C T 10: 108,262,381 R321* probably null Het
Pxdn A G 12: 30,014,583 probably null Het
Rab44 A T 17: 29,139,227 I130F probably benign Het
Rnf130 T C 11: 50,071,264 I179T probably damaging Het
Slc22a28 A T 19: 8,064,491 C450* probably null Het
Slco1c1 A T 6: 141,540,052 Y136F probably damaging Het
Synj2 C T 17: 6,017,569 Q106* probably null Het
Uckl1 T C 2: 181,574,493 N138S probably damaging Het
Usp19 G T 9: 108,498,819 E203* probably null Het
Vdr A G 15: 97,857,505 I379T probably damaging Het
Zfp503 C A 14: 21,986,033 G272C probably damaging Het
Zfyve9 T C 4: 108,644,361 N1218S possibly damaging Het
Zzz3 T A 3: 152,428,053 D249E probably benign Het
Other mutations in Cop1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02572:Cop1 APN 1 159308878 unclassified probably benign
IGL02945:Cop1 APN 1 159306689 missense probably benign 0.20
IGL03059:Cop1 APN 1 159306709 missense probably damaging 1.00
R0032:Cop1 UTSW 1 159325036 critical splice donor site probably null
R0179:Cop1 UTSW 1 159250066 missense probably benign 0.20
R0846:Cop1 UTSW 1 159319816 missense probably benign 0.26
R0988:Cop1 UTSW 1 159232847 missense possibly damaging 0.76
R0988:Cop1 UTSW 1 159244672 missense probably damaging 1.00
R2296:Cop1 UTSW 1 159244650 missense possibly damaging 0.92
R2297:Cop1 UTSW 1 159252554 missense possibly damaging 0.53
R2504:Cop1 UTSW 1 159232805 missense probably damaging 0.98
R2974:Cop1 UTSW 1 159324929 missense possibly damaging 0.95
R4889:Cop1 UTSW 1 159284589 missense probably damaging 1.00
R4965:Cop1 UTSW 1 159239597 missense probably damaging 0.99
R4981:Cop1 UTSW 1 159325068 unclassified probably benign
R5124:Cop1 UTSW 1 159278112 missense probably damaging 0.96
R5263:Cop1 UTSW 1 159324937 missense probably damaging 1.00
R5268:Cop1 UTSW 1 159327164 missense probably damaging 1.00
R5470:Cop1 UTSW 1 159266860 intron probably benign
R5595:Cop1 UTSW 1 159250073 missense probably benign 0.00
R5919:Cop1 UTSW 1 159319724 missense probably damaging 1.00
R6386:Cop1 UTSW 1 159289031 missense probably damaging 1.00
R6995:Cop1 UTSW 1 159306584 missense probably damaging 1.00
R7056:Cop1 UTSW 1 159250077 missense probably damaging 0.98
R7146:Cop1 UTSW 1 159244352 intron probably null
R7242:Cop1 UTSW 1 159284548 missense probably benign 0.00
R7309:Cop1 UTSW 1 159306625 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTCACCACCCCATGTCAATAAATTG -3'
(R):5'- TTGCCAGGAATTCAGTTTGC -3'

Sequencing Primer
(F):5'- ACCCCATGTCAATAAATTGTTTCTC -3'
(R):5'- GCATTACTGTGAAAAGGCTGTAC -3'
Posted On2018-10-18