Incidental Mutation 'R6866:Serping1'
ID535900
Institutional Source Beutler Lab
Gene Symbol Serping1
Ensembl Gene ENSMUSG00000023224
Gene Nameserine (or cysteine) peptidase inhibitor, clade G, member 1
SynonymsC1INH, C1 inhibitor, C1nh
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.281) question?
Stock #R6866 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location84765387-84775444 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 84770233 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 255 (V255G)
Ref Sequence ENSEMBL: ENSMUSP00000107268 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023994] [ENSMUST00000111641]
Predicted Effect probably benign
Transcript: ENSMUST00000023994
AA Change: V255G

PolyPhen 2 Score 0.416 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000023994
Gene: ENSMUSG00000023224
AA Change: V255G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
SERPIN 156 502 3.26e-97 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111641
AA Change: V255G

PolyPhen 2 Score 0.416 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000107268
Gene: ENSMUSG00000023224
AA Change: V255G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
SERPIN 156 347 5.39e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a highly glycosylated plasma protein involved in the regulation of the complement cascade. Its protein inhibits activated C1r and C1s of the first complement component and thus regulates complement activation. Deficiency of this protein is associated with hereditary angioneurotic oedema (HANE). Alternative splicing results in multiple transcript variants encoding the same isoform. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant mice exhibit an increased vascular permeability compared to controls. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik ACTGCACCACCT ACT 10: 43,532,725 probably benign Het
Alms1 A G 6: 85,621,098 T1438A possibly damaging Het
Als2 T A 1: 59,211,133 Q484L probably damaging Het
Apeh G A 9: 108,092,679 H186Y probably damaging Het
BC051142 T A 17: 34,459,961 C216S possibly damaging Het
Bcl2l13 T A 6: 120,862,889 N49K probably benign Het
Bptf T C 11: 107,073,580 D1596G probably damaging Het
Brsk1 T C 7: 4,706,407 M325T probably damaging Het
C87499 T A 4: 88,627,740 D455V probably damaging Het
Caly T C 7: 140,070,619 M137V probably benign Het
Cdca2 T C 14: 67,693,666 E526G possibly damaging Het
Cnga4 A G 7: 105,407,745 S352G possibly damaging Het
Cntnap5c A C 17: 58,092,294 T381P probably benign Het
Cr2 T A 1: 195,151,691 Y633F probably damaging Het
Cryba1 T C 11: 77,719,529 N120S probably benign Het
Cyfip2 G A 11: 46,242,459 R805* probably null Het
Dnah7c C A 1: 46,657,243 P2095Q probably damaging Het
Eif3k T C 7: 28,977,226 E110G possibly damaging Het
Extl2 A G 3: 116,027,352 M283V probably damaging Het
Extl2 T A 3: 116,027,353 M283K probably damaging Het
Focad T C 4: 88,403,386 I1658T probably benign Het
Fstl5 A T 3: 76,322,225 H111L probably damaging Het
Garnl3 A G 2: 33,002,773 probably null Het
Gm3633 T A 14: 42,640,622 probably benign Het
Il4i1 T A 7: 44,836,539 probably null Het
Kcnj6 A T 16: 94,762,677 C321S probably damaging Het
Kif20a A T 18: 34,628,493 Y313F probably benign Het
Kmt2d T G 15: 98,857,393 probably benign Het
Kynu T A 2: 43,563,110 Y48* probably null Het
Ly9 T C 1: 171,605,279 I55M probably damaging Het
Mgme1 T C 2: 144,276,519 V237A probably damaging Het
Mmp16 T A 4: 17,853,800 L27H probably benign Het
Myh1 A C 11: 67,224,393 D1918A probably damaging Het
Myo5a G A 9: 75,140,688 C266Y probably damaging Het
Nckap5l A G 15: 99,426,468 I718T probably benign Het
Nptx1 A G 11: 119,546,650 probably null Het
Olfr180 A G 16: 58,915,988 Y218H probably damaging Het
Olfr502 A G 7: 108,523,170 F260S probably damaging Het
Olfr682-ps1 T A 7: 105,126,618 M228L probably benign Het
Phc3 T A 3: 30,914,531 K783* probably null Het
Pkdrej A T 15: 85,820,881 C285S probably damaging Het
Pot1b T A 17: 55,653,474 T619S possibly damaging Het
Psg21 A T 7: 18,652,284 V259E probably damaging Het
Pvr A C 7: 19,918,630 I120S probably benign Het
Rbm17 T G 2: 11,598,090 I68L probably benign Het
Rnf138 C T 18: 21,002,142 P28L probably damaging Het
Rnf207 C T 4: 152,312,532 C385Y possibly damaging Het
Slc25a3 A T 10: 91,119,705 V91E probably damaging Het
Slc26a8 T C 17: 28,638,481 D896G probably benign Het
Slc27a5 T A 7: 12,997,516 T183S probably benign Het
Slc33a1 A T 3: 63,943,323 F527I probably benign Het
Strn4 A T 7: 16,828,785 D283V probably damaging Het
Sult1e1 G A 5: 87,586,766 T107I probably damaging Het
Tango6 G A 8: 106,742,472 probably null Het
Tecrl G T 5: 83,313,314 P99T probably damaging Het
Ticrr T C 7: 79,693,957 L1190P possibly damaging Het
Timm50 C T 7: 28,305,945 R349H probably damaging Het
Tjp2 A G 19: 24,101,991 I840T probably damaging Het
Tmem173 T C 18: 35,739,429 H50R probably damaging Het
Tmem45a2 T A 16: 57,047,023 N105I probably damaging Het
Zfp148 T A 16: 33,468,126 C162S probably damaging Het
Zfp534 T C 4: 147,674,481 K577R probably benign Het
Other mutations in Serping1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01376:Serping1 APN 2 84770185 missense probably damaging 1.00
IGL01791:Serping1 APN 2 84773377 missense possibly damaging 0.68
IGL01903:Serping1 APN 2 84769772 critical splice donor site probably null
IGL03182:Serping1 APN 2 84765818 missense probably damaging 1.00
R0094:Serping1 UTSW 2 84773276 missense probably benign 0.00
R0548:Serping1 UTSW 2 84770081 splice site probably benign
R0782:Serping1 UTSW 2 84767446 missense probably damaging 1.00
R1585:Serping1 UTSW 2 84771504 missense probably benign 0.33
R1900:Serping1 UTSW 2 84771449 missense probably damaging 0.99
R1965:Serping1 UTSW 2 84765728 missense probably damaging 1.00
R1966:Serping1 UTSW 2 84765728 missense probably damaging 1.00
R2252:Serping1 UTSW 2 84769851 missense probably damaging 0.99
R2426:Serping1 UTSW 2 84770219 missense probably damaging 0.99
R4997:Serping1 UTSW 2 84770285 missense possibly damaging 0.74
R5665:Serping1 UTSW 2 84771545 missense probably damaging 0.99
R6192:Serping1 UTSW 2 84770268 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TCTGTGGAACTCTGAGCCTG -3'
(R):5'- TCCAGCATTTTGTCATCGTTGG -3'

Sequencing Primer
(F):5'- TGGAACTCTGAGCCTGGAGAC -3'
(R):5'- GTGAGTTCTAGGCTAGTCAAAGCTAC -3'
Posted On2018-10-18