Incidental Mutation 'R6866:1700021F05Rik'
List |< first << previous [record 4 of 585] next >> last >|
ID535932
Institutional Source Beutler Lab
Gene Symbol 1700021F05Rik
Ensembl Gene ENSMUSG00000019797
Gene NameRIKEN cDNA 1700021F05 gene
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.291) question?
Stock #R6866 (G1)
Quality Score217.468
Status Not validated
Chromosome10
Chromosomal Location43525133-43540994 bp(-) (GRCm38)
Type of Mutationsmall deletion (3 aa in frame mutation)
DNA Base Change (assembly) ACTGCACCACCT to ACT at 43532725 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000147196]
Predicted Effect probably benign
Transcript: ENSMUST00000147196
SMART Domains Protein: ENSMUSP00000119053
Gene: ENSMUSG00000019797

DomainStartEndE-ValueType
low complexity region 84 96 N/A INTRINSIC
low complexity region 100 125 N/A INTRINSIC
Blast:S4 142 188 1e-19 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alms1 A G 6: 85,621,098 T1438A possibly damaging Het
Als2 T A 1: 59,211,133 Q484L probably damaging Het
Apeh G A 9: 108,092,679 H186Y probably damaging Het
BC051142 T A 17: 34,459,961 C216S possibly damaging Het
Bcl2l13 T A 6: 120,862,889 N49K probably benign Het
Bptf T C 11: 107,073,580 D1596G probably damaging Het
Brsk1 T C 7: 4,706,407 M325T probably damaging Het
C87499 T A 4: 88,627,740 D455V probably damaging Het
Caly T C 7: 140,070,619 M137V probably benign Het
Cdca2 T C 14: 67,693,666 E526G possibly damaging Het
Cnga4 A G 7: 105,407,745 S352G possibly damaging Het
Cntnap5c A C 17: 58,092,294 T381P probably benign Het
Cr2 T A 1: 195,151,691 Y633F probably damaging Het
Cryba1 T C 11: 77,719,529 N120S probably benign Het
Cyfip2 G A 11: 46,242,459 R805* probably null Het
Dnah7c C A 1: 46,657,243 P2095Q probably damaging Het
Eif3k T C 7: 28,977,226 E110G possibly damaging Het
Extl2 A G 3: 116,027,352 M283V probably damaging Het
Extl2 T A 3: 116,027,353 M283K probably damaging Het
Focad T C 4: 88,403,386 I1658T probably benign Het
Fstl5 A T 3: 76,322,225 H111L probably damaging Het
Garnl3 A G 2: 33,002,773 probably null Het
Gm3633 T A 14: 42,640,622 probably benign Het
Il4i1 T A 7: 44,836,539 probably null Het
Kcnj6 A T 16: 94,762,677 C321S probably damaging Het
Kif20a A T 18: 34,628,493 Y313F probably benign Het
Kmt2d T G 15: 98,857,393 probably benign Het
Kynu T A 2: 43,563,110 Y48* probably null Het
Ly9 T C 1: 171,605,279 I55M probably damaging Het
Mgme1 T C 2: 144,276,519 V237A probably damaging Het
Mmp16 T A 4: 17,853,800 L27H probably benign Het
Myh1 A C 11: 67,224,393 D1918A probably damaging Het
Myo5a G A 9: 75,140,688 C266Y probably damaging Het
Nckap5l A G 15: 99,426,468 I718T probably benign Het
Nptx1 A G 11: 119,546,650 probably null Het
Olfr180 A G 16: 58,915,988 Y218H probably damaging Het
Olfr502 A G 7: 108,523,170 F260S probably damaging Het
Olfr682-ps1 T A 7: 105,126,618 M228L probably benign Het
Phc3 T A 3: 30,914,531 K783* probably null Het
Pkdrej A T 15: 85,820,881 C285S probably damaging Het
Pot1b T A 17: 55,653,474 T619S possibly damaging Het
Psg21 A T 7: 18,652,284 V259E probably damaging Het
Pvr A C 7: 19,918,630 I120S probably benign Het
Rbm17 T G 2: 11,598,090 I68L probably benign Het
Rnf138 C T 18: 21,002,142 P28L probably damaging Het
Rnf207 C T 4: 152,312,532 C385Y possibly damaging Het
Serping1 A C 2: 84,770,233 V255G probably benign Het
Slc25a3 A T 10: 91,119,705 V91E probably damaging Het
Slc26a8 T C 17: 28,638,481 D896G probably benign Het
Slc27a5 T A 7: 12,997,516 T183S probably benign Het
Slc33a1 A T 3: 63,943,323 F527I probably benign Het
Strn4 A T 7: 16,828,785 D283V probably damaging Het
Sult1e1 G A 5: 87,586,766 T107I probably damaging Het
Tango6 G A 8: 106,742,472 probably null Het
Tecrl G T 5: 83,313,314 P99T probably damaging Het
Ticrr T C 7: 79,693,957 L1190P possibly damaging Het
Timm50 C T 7: 28,305,945 R349H probably damaging Het
Tjp2 A G 19: 24,101,991 I840T probably damaging Het
Tmem173 T C 18: 35,739,429 H50R probably damaging Het
Tmem45a2 T A 16: 57,047,023 N105I probably damaging Het
Zfp148 T A 16: 33,468,126 C162S probably damaging Het
Zfp534 T C 4: 147,674,481 K577R probably benign Het
Other mutations in 1700021F05Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1531:1700021F05Rik UTSW 10 43525320 missense probably benign 0.01
R2497:1700021F05Rik UTSW 10 43525267 unclassified probably benign
R4280:1700021F05Rik UTSW 10 43532909 missense probably benign 0.03
R4574:1700021F05Rik UTSW 10 43533010 missense probably damaging 1.00
R5460:1700021F05Rik UTSW 10 43532865 missense probably benign 0.07
R5782:1700021F05Rik UTSW 10 43532903 missense probably benign 0.05
R6103:1700021F05Rik UTSW 10 43532920 missense probably benign 0.08
R6850:1700021F05Rik UTSW 10 43532725 small deletion probably benign
R6867:1700021F05Rik UTSW 10 43532725 small deletion probably benign
R6899:1700021F05Rik UTSW 10 43532784 missense possibly damaging 0.47
X0022:1700021F05Rik UTSW 10 43525383 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTCACGTGTAAAGTCCTTTC -3'
(R):5'- CGACTCCCAGAGCTTTTAGTATC -3'

Sequencing Primer
(F):5'- CGTGTAAAGTCCTTTCACATCTATGG -3'
(R):5'- CCAGAGCTTTTAGTATCTCCAGAATG -3'
Posted On2018-10-18