Incidental Mutation 'R6866:Slc25a3'
ID535933
Institutional Source Beutler Lab
Gene Symbol Slc25a3
Ensembl Gene ENSMUSG00000061904
Gene Namesolute carrier family 25 (mitochondrial carrier, phosphate carrier), member 3
Synonyms5730556H19Rik, Phc
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6866 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location91116574-91124059 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 91119705 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 91 (V91E)
Ref Sequence ENSEMBL: ENSMUSP00000127098 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076694] [ENSMUST00000163246] [ENSMUST00000164505] [ENSMUST00000170810]
Predicted Effect probably damaging
Transcript: ENSMUST00000076694
AA Change: V90E

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000075987
Gene: ENSMUSG00000061904
AA Change: V90E

DomainStartEndE-ValueType
low complexity region 29 46 N/A INTRINSIC
Pfam:Mito_carr 58 147 3.9e-23 PFAM
Pfam:Mito_carr 156 243 4.8e-19 PFAM
Pfam:Mito_carr 254 338 3.7e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163246
SMART Domains Protein: ENSMUSP00000129301
Gene: ENSMUSG00000061904

DomainStartEndE-ValueType
low complexity region 29 46 N/A INTRINSIC
low complexity region 56 73 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164505
AA Change: V90E

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000132480
Gene: ENSMUSG00000061904
AA Change: V90E

DomainStartEndE-ValueType
low complexity region 29 46 N/A INTRINSIC
Pfam:Mito_carr 58 147 3.9e-23 PFAM
Pfam:Mito_carr 156 243 4.8e-19 PFAM
Pfam:Mito_carr 254 338 3.7e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170810
AA Change: V91E

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000127098
Gene: ENSMUSG00000061904
AA Change: V91E

DomainStartEndE-ValueType
low complexity region 29 46 N/A INTRINSIC
Pfam:Mito_carr 59 147 8.6e-21 PFAM
Pfam:Mito_carr 157 245 4.4e-19 PFAM
Pfam:Mito_carr 255 339 2.8e-10 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the transport of phosphate into the mitochondrial matrix, either by proton cotransport or in exchange for hydroxyl ions. The protein contains three related segments arranged in tandem which are related to those found in other characterized members of the mitochondrial carrier family. Both the N-terminal and C-terminal regions of this protein protrude toward the cytosol. Multiple alternatively spliced transcript variants have been isolated. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik ACTGCACCACCT ACT 10: 43,532,725 probably benign Het
Alms1 A G 6: 85,621,098 T1438A possibly damaging Het
Als2 T A 1: 59,211,133 Q484L probably damaging Het
Apeh G A 9: 108,092,679 H186Y probably damaging Het
BC051142 T A 17: 34,459,961 C216S possibly damaging Het
Bcl2l13 T A 6: 120,862,889 N49K probably benign Het
Bptf T C 11: 107,073,580 D1596G probably damaging Het
Brsk1 T C 7: 4,706,407 M325T probably damaging Het
C87499 T A 4: 88,627,740 D455V probably damaging Het
Caly T C 7: 140,070,619 M137V probably benign Het
Cdca2 T C 14: 67,693,666 E526G possibly damaging Het
Cnga4 A G 7: 105,407,745 S352G possibly damaging Het
Cntnap5c A C 17: 58,092,294 T381P probably benign Het
Cr2 T A 1: 195,151,691 Y633F probably damaging Het
Cryba1 T C 11: 77,719,529 N120S probably benign Het
Cyfip2 G A 11: 46,242,459 R805* probably null Het
Dnah7c C A 1: 46,657,243 P2095Q probably damaging Het
Eif3k T C 7: 28,977,226 E110G possibly damaging Het
Extl2 A G 3: 116,027,352 M283V probably damaging Het
Extl2 T A 3: 116,027,353 M283K probably damaging Het
Focad T C 4: 88,403,386 I1658T probably benign Het
Fstl5 A T 3: 76,322,225 H111L probably damaging Het
Garnl3 A G 2: 33,002,773 probably null Het
Gm3633 T A 14: 42,640,622 probably benign Het
Il4i1 T A 7: 44,836,539 probably null Het
Kcnj6 A T 16: 94,762,677 C321S probably damaging Het
Kif20a A T 18: 34,628,493 Y313F probably benign Het
Kmt2d T G 15: 98,857,393 probably benign Het
Kynu T A 2: 43,563,110 Y48* probably null Het
Ly9 T C 1: 171,605,279 I55M probably damaging Het
Mgme1 T C 2: 144,276,519 V237A probably damaging Het
Mmp16 T A 4: 17,853,800 L27H probably benign Het
Myh1 A C 11: 67,224,393 D1918A probably damaging Het
Myo5a G A 9: 75,140,688 C266Y probably damaging Het
Nckap5l A G 15: 99,426,468 I718T probably benign Het
Nptx1 A G 11: 119,546,650 probably null Het
Olfr180 A G 16: 58,915,988 Y218H probably damaging Het
Olfr502 A G 7: 108,523,170 F260S probably damaging Het
Olfr682-ps1 T A 7: 105,126,618 M228L probably benign Het
Phc3 T A 3: 30,914,531 K783* probably null Het
Pkdrej A T 15: 85,820,881 C285S probably damaging Het
Pot1b T A 17: 55,653,474 T619S possibly damaging Het
Psg21 A T 7: 18,652,284 V259E probably damaging Het
Pvr A C 7: 19,918,630 I120S probably benign Het
Rbm17 T G 2: 11,598,090 I68L probably benign Het
Rnf138 C T 18: 21,002,142 P28L probably damaging Het
Rnf207 C T 4: 152,312,532 C385Y possibly damaging Het
Serping1 A C 2: 84,770,233 V255G probably benign Het
Slc26a8 T C 17: 28,638,481 D896G probably benign Het
Slc27a5 T A 7: 12,997,516 T183S probably benign Het
Slc33a1 A T 3: 63,943,323 F527I probably benign Het
Strn4 A T 7: 16,828,785 D283V probably damaging Het
Sult1e1 G A 5: 87,586,766 T107I probably damaging Het
Tango6 G A 8: 106,742,472 probably null Het
Tecrl G T 5: 83,313,314 P99T probably damaging Het
Ticrr T C 7: 79,693,957 L1190P possibly damaging Het
Timm50 C T 7: 28,305,945 R349H probably damaging Het
Tjp2 A G 19: 24,101,991 I840T probably damaging Het
Tmem173 T C 18: 35,739,429 H50R probably damaging Het
Tmem45a2 T A 16: 57,047,023 N105I probably damaging Het
Zfp148 T A 16: 33,468,126 C162S probably damaging Het
Zfp534 T C 4: 147,674,481 K577R probably benign Het
Other mutations in Slc25a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01702:Slc25a3 APN 10 91118125 missense probably damaging 0.96
IGL02193:Slc25a3 APN 10 91118115 missense probably benign 0.01
R1215:Slc25a3 UTSW 10 91117308 missense possibly damaging 0.95
R4737:Slc25a3 UTSW 10 91122188 missense possibly damaging 0.66
R5418:Slc25a3 UTSW 10 91119536 missense probably benign
R5799:Slc25a3 UTSW 10 91122041 missense probably benign
R6228:Slc25a3 UTSW 10 91122228 missense probably damaging 0.98
R6269:Slc25a3 UTSW 10 91117101 nonsense probably null
R6414:Slc25a3 UTSW 10 91122328 missense possibly damaging 0.66
R7404:Slc25a3 UTSW 10 91117040 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- TCACCAAGTATGTTGCTATATAAGGCT -3'
(R):5'- GAAGCATATACACAGGAATATACCAC -3'

Sequencing Primer
(F):5'- GCTTTGAAGACTTCATAAAAGCCG -3'
(R):5'- GCTAAGAACTTTCATATACCTTTTG -3'
Posted On2018-10-18