Incidental Mutation 'R6867:Apold1'
ID535971
Institutional Source Beutler Lab
Gene Symbol Apold1
Ensembl Gene ENSMUSG00000090698
Gene Nameapolipoprotein L domain containing 1
SynonymsLOC381823
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.356) question?
Stock #R6867 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location134981718-134986836 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 134984056 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 158 (S158P)
Ref Sequence ENSEMBL: ENSMUSP00000132366 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167323]
Predicted Effect possibly damaging
Transcript: ENSMUST00000167323
AA Change: S158P

PolyPhen 2 Score 0.603 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000132366
Gene: ENSMUSG00000090698
AA Change: S158P

DomainStartEndE-ValueType
Pfam:ApoL 16 143 1.5e-16 PFAM
coiled coil region 192 220 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] APOLD1 is an endothelial cell early response protein that may play a role in regulation of endothelial cell signaling and vascular function (Regard et al., 2004 [PubMed 15102925]).[supplied by OMIM, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik ACTGCACCACCT ACT 10: 43,532,725 probably benign Het
Cep162 A T 9: 87,217,081 L788* probably null Het
Cyp7b1 T C 3: 18,097,230 Y273C probably damaging Het
Dlx1 C A 2: 71,531,009 N122K probably damaging Het
Dock10 A T 1: 80,531,259 I1605K probably damaging Het
Enox1 T C 14: 77,699,299 probably null Het
F3 T C 3: 121,729,371 S77P possibly damaging Het
Fam186a T A 15: 99,945,850 I838L unknown Het
Flrt2 T C 12: 95,779,382 F165L probably damaging Het
Gcgr T A 11: 120,536,469 V135E possibly damaging Het
Gm6741 T C 17: 91,236,911 L34P probably benign Het
Gna13 T C 11: 109,396,122 M257T possibly damaging Het
Hsd11b2 G A 8: 105,522,317 R147H probably benign Het
Hydin A G 8: 110,539,802 Y2865C probably benign Het
Igdcc3 A G 9: 65,183,038 N610D probably damaging Het
Ipp T A 4: 116,510,409 probably null Het
Kdm5d A G Y: 927,425 T682A probably benign Het
Megf8 A G 7: 25,331,035 Y471C probably benign Het
Mprip T C 11: 59,749,630 probably null Het
Myrfl T A 10: 116,848,282 R179* probably null Het
Nek1 C A 8: 61,072,330 Q601K possibly damaging Het
Neurod4 C G 10: 130,270,714 K230N probably damaging Het
Olfr1037 A G 2: 86,085,738 I13T possibly damaging Het
Olfr374 C T 8: 72,109,863 T99I possibly damaging Het
Orc3 A G 4: 34,605,539 L114P probably damaging Het
Rag1 T C 2: 101,641,947 D950G probably damaging Het
Rasgrp2 G A 19: 6,413,183 S504N probably benign Het
Rgl2 A G 17: 33,932,687 D235G probably benign Het
Slc35e2 A G 4: 155,618,700 E390G probably benign Het
Slc39a1 T A 3: 90,249,452 V105E probably damaging Het
Tesk2 T A 4: 116,801,798 C291S probably damaging Het
Tmco3 T A 8: 13,313,927 F83Y probably damaging Het
Trim25 T C 11: 89,010,887 I336T probably benign Het
Ush2a A G 1: 188,910,973 I4177M probably damaging Het
Veph1 T A 3: 66,255,037 T67S probably damaging Het
Vmn2r43 A G 7: 8,255,126 F363L probably benign Het
Vps28 A T 15: 76,622,671 I109N probably damaging Het
Vps50 A G 6: 3,517,835 D91G probably benign Het
Wdr20 T C 12: 110,793,699 F340L probably benign Het
Wdr95 A G 5: 149,580,923 probably null Het
Zfand6 A G 7: 84,615,914 V193A probably damaging Het
Zfp703 C A 8: 26,978,640 P111T probably damaging Het
Other mutations in Apold1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0581:Apold1 UTSW 6 134983813 missense probably benign 0.00
R4013:Apold1 UTSW 6 134983906 missense probably benign
R4016:Apold1 UTSW 6 134983906 missense probably benign
R4017:Apold1 UTSW 6 134983906 missense probably benign
R4599:Apold1 UTSW 6 134984069 missense probably damaging 1.00
R4909:Apold1 UTSW 6 134983595 missense probably benign 0.00
R5154:Apold1 UTSW 6 134983673 missense possibly damaging 0.62
R5275:Apold1 UTSW 6 134983800 missense probably damaging 1.00
R5850:Apold1 UTSW 6 134984095 missense probably damaging 0.99
R5958:Apold1 UTSW 6 134983723 missense probably damaging 1.00
R6802:Apold1 UTSW 6 134983730 missense probably damaging 1.00
R7012:Apold1 UTSW 6 134984044 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCGTGGGGTTGTCACTCAG -3'
(R):5'- CTCACTAAGTTCATCCAGGGC -3'

Sequencing Primer
(F):5'- AGGGGCAGTCACCATCAC -3'
(R):5'- TAAGTTCATCCAGGGCGCCAG -3'
Posted On2018-10-18