Incidental Mutation 'R6867:Olfr374'
ID535978
Institutional Source Beutler Lab
Gene Symbol Olfr374
Ensembl Gene ENSMUSG00000046881
Gene Nameolfactory receptor 374
SynonymsGA_x6K02T2NUPS-241490-242431, MOR130-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R6867 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location72107040-72118200 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 72109863 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 99 (T99I)
Ref Sequence ENSEMBL: ENSMUSP00000147605 (fasta)
Predicted Effect possibly damaging
Transcript: ENSMUST00000209675
AA Change: T99I

PolyPhen 2 Score 0.902 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000210435
AA Change: T99I

PolyPhen 2 Score 0.902 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik ACTGCACCACCT ACT 10: 43,532,725 probably benign Het
Apold1 T C 6: 134,984,056 S158P possibly damaging Het
Cep162 A T 9: 87,217,081 L788* probably null Het
Cyp7b1 T C 3: 18,097,230 Y273C probably damaging Het
Dlx1 C A 2: 71,531,009 N122K probably damaging Het
Dock10 A T 1: 80,531,259 I1605K probably damaging Het
Enox1 T C 14: 77,699,299 probably null Het
F3 T C 3: 121,729,371 S77P possibly damaging Het
Fam186a T A 15: 99,945,850 I838L unknown Het
Flrt2 T C 12: 95,779,382 F165L probably damaging Het
Gcgr T A 11: 120,536,469 V135E possibly damaging Het
Gm6741 T C 17: 91,236,911 L34P probably benign Het
Gna13 T C 11: 109,396,122 M257T possibly damaging Het
Hsd11b2 G A 8: 105,522,317 R147H probably benign Het
Hydin A G 8: 110,539,802 Y2865C probably benign Het
Igdcc3 A G 9: 65,183,038 N610D probably damaging Het
Ipp T A 4: 116,510,409 probably null Het
Kdm5d A G Y: 927,425 T682A probably benign Het
Megf8 A G 7: 25,331,035 Y471C probably benign Het
Mprip T C 11: 59,749,630 probably null Het
Myrfl T A 10: 116,848,282 R179* probably null Het
Nek1 C A 8: 61,072,330 Q601K possibly damaging Het
Neurod4 C G 10: 130,270,714 K230N probably damaging Het
Olfr1037 A G 2: 86,085,738 I13T possibly damaging Het
Orc3 A G 4: 34,605,539 L114P probably damaging Het
Rag1 T C 2: 101,641,947 D950G probably damaging Het
Rasgrp2 G A 19: 6,413,183 S504N probably benign Het
Rgl2 A G 17: 33,932,687 D235G probably benign Het
Slc35e2 A G 4: 155,618,700 E390G probably benign Het
Slc39a1 T A 3: 90,249,452 V105E probably damaging Het
Tesk2 T A 4: 116,801,798 C291S probably damaging Het
Tmco3 T A 8: 13,313,927 F83Y probably damaging Het
Trim25 T C 11: 89,010,887 I336T probably benign Het
Ush2a A G 1: 188,910,973 I4177M probably damaging Het
Veph1 T A 3: 66,255,037 T67S probably damaging Het
Vmn2r43 A G 7: 8,255,126 F363L probably benign Het
Vps28 A T 15: 76,622,671 I109N probably damaging Het
Vps50 A G 6: 3,517,835 D91G probably benign Het
Wdr20 T C 12: 110,793,699 F340L probably benign Het
Wdr95 A G 5: 149,580,923 probably null Het
Zfand6 A G 7: 84,615,914 V193A probably damaging Het
Zfp703 C A 8: 26,978,640 P111T probably damaging Het
Other mutations in Olfr374
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03022:Olfr374 APN 8 72110124 missense probably damaging 0.99
IGL03059:Olfr374 APN 8 72109998 missense probably damaging 1.00
R1662:Olfr374 UTSW 8 72109779 missense probably benign 0.09
R1977:Olfr374 UTSW 8 72109854 missense probably benign 0.41
R3965:Olfr374 UTSW 8 72110264 missense probably damaging 1.00
R4577:Olfr374 UTSW 8 72110323 nonsense probably null
R4702:Olfr374 UTSW 8 72110200 missense probably damaging 1.00
R4703:Olfr374 UTSW 8 72110200 missense probably damaging 1.00
R4705:Olfr374 UTSW 8 72110200 missense probably damaging 1.00
R4909:Olfr374 UTSW 8 72109581 missense probably damaging 1.00
R6542:Olfr374 UTSW 8 72109871 missense probably damaging 0.98
R7094:Olfr374 UTSW 8 72109503 intron probably benign
R7148:Olfr374 UTSW 8 72110157 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- TGCCTTCCTGAGCATGTACC -3'
(R):5'- TCAGAAGGACTGTGTGGGTCAG -3'

Sequencing Primer
(F):5'- GAGCATGTACCTTCTCACAGG -3'
(R):5'- TCAGGGCATTTGCAAAGGCTG -3'
Posted On2018-10-18