Mutagenetix > Incidental Mutation

Incidental Mutation 'R6867:Hsd11b2'

535979

Institutional Source

Beutler Lab

Gene Symbol

Hsd11b2

Ensembl Gene

ENSMUSG00000031891

Gene Name

hydroxysteroid 11-beta dehydrogenase 2

Synonyms

11(beta)-HSD2, 11HSD2

MMRRC Submission

045028-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6867 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

106245387-106250620 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 106248949 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Histidine at position 147 (R147H)

Ref Sequence

ENSEMBL: ENSMUSP00000034363 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000013304] [ENSMUST00000034363]

AlphaFold

P51661

Predicted Effect

probably benign
Transcript: ENSMUST00000013304

SMART Domains

Protein: ENSMUSP00000013304
Gene: ENSMUSG00000013160

Domain	Start	End	E-Value	Type
Pfam:vATP-synt_AC39	16	347	2.4e-116	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000034363
AA Change: R147H

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000034363
Gene: ENSMUSG00000031891
AA Change: R147H

Domain	Start	End	E-Value	Type
low complexity region	11	32	N/A	INTRINSIC
low complexity region	34	44	N/A	INTRINSIC
low complexity region	51	65	N/A	INTRINSIC
Pfam:adh_short	83	278	9.2e-47	PFAM
Pfam:adh_short_C2	89	294	2e-11	PFAM

Meta Mutation Damage Score

0.0731

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.0%

Validation Efficiency

100% (43/43)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] There are at least two isozymes of the corticosteroid 11-beta-dehydrogenase, a microsomal enzyme complex responsible for the interconversion of cortisol and cortisone. The type I isozyme has both 11-beta-dehydrogenase (cortisol to cortisone) and 11-oxoreductase (cortisone to cortisol) activities. The type II isozyme, encoded by this gene, has only 11-beta-dehydrogenase activity. In aldosterone-selective epithelial tissues such as the kidney, the type II isozyme catalyzes the glucocorticoid cortisol to the inactive metabolite cortisone, thus preventing illicit activation of the mineralocorticoid receptor. In tissues that do not express the mineralocorticoid receptor, such as the placenta and testis, it protects cells from the growth-inhibiting and/or pro-apoptotic effects of cortisol, particularly during embryonic development. Mutations in this gene cause the syndrome of apparent mineralocorticoid excess and hypertension. [provided by RefSeq, Feb 2010]
PHENOTYPE: About half of all mice homozygous for disruptions in this gene die within 48 hours of birth. Survivors are subject to sudden unexplained deaths when between 2 and 4 months of age. They are hypertensive with dilute urine and are hypokalemic and hypochloremic. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Apold1	T	C	6: 134,961,019 (GRCm39)	S158P	possibly damaging	Het
Cep162	A	T	9: 87,099,134 (GRCm39)	L788*	probably null	Het
Cyp7b1	T	C	3: 18,151,394 (GRCm39)	Y273C	probably damaging	Het
Dlx1	C	A	2: 71,361,353 (GRCm39)	N122K	probably damaging	Het
Dock10	A	T	1: 80,508,976 (GRCm39)	I1605K	probably damaging	Het
Enox1	T	C	14: 77,936,739 (GRCm39)		probably null	Het
F3	T	C	3: 121,523,020 (GRCm39)	S77P	possibly damaging	Het
Fam186a	T	A	15: 99,843,731 (GRCm39)	I838L	unknown	Het
Flrt2	T	C	12: 95,746,156 (GRCm39)	F165L	probably damaging	Het
Gcgr	T	A	11: 120,427,295 (GRCm39)	V135E	possibly damaging	Het
Gm6741	T	C	17: 91,544,339 (GRCm39)	L34P	probably benign	Het
Gna13	T	C	11: 109,286,948 (GRCm39)	M257T	possibly damaging	Het
Hydin	A	G	8: 111,266,434 (GRCm39)	Y2865C	probably benign	Het
Igdcc3	A	G	9: 65,090,320 (GRCm39)	N610D	probably damaging	Het
Ipp	T	A	4: 116,367,606 (GRCm39)		probably null	Het
Kdm5d	A	G	Y: 927,425 (GRCm39)	T682A	probably benign	Het
Megf8	A	G	7: 25,030,460 (GRCm39)	Y471C	probably benign	Het
Mprip	T	C	11: 59,640,456 (GRCm39)		probably null	Het
Mtres1	ACTGCACCACCT	ACT	10: 43,408,721 (GRCm39)		probably benign	Het
Myrfl	T	A	10: 116,684,187 (GRCm39)	R179*	probably null	Het
Nek1	C	A	8: 61,525,364 (GRCm39)	Q601K	possibly damaging	Het
Neurod4	C	G	10: 130,106,583 (GRCm39)	K230N	probably damaging	Het
Or1ab2	C	T	8: 72,863,707 (GRCm39)	T99I	possibly damaging	Het
Or8u10	A	G	2: 85,916,082 (GRCm39)	I13T	possibly damaging	Het
Orc3	A	G	4: 34,605,539 (GRCm39)	L114P	probably damaging	Het
Rag1	T	C	2: 101,472,292 (GRCm39)	D950G	probably damaging	Het
Rasgrp2	G	A	19: 6,463,213 (GRCm39)	S504N	probably benign	Het
Rgl2	A	G	17: 34,151,661 (GRCm39)	D235G	probably benign	Het
Slc35e2	A	G	4: 155,703,157 (GRCm39)	E390G	probably benign	Het
Slc39a1	T	A	3: 90,156,759 (GRCm39)	V105E	probably damaging	Het
Tesk2	T	A	4: 116,658,995 (GRCm39)	C291S	probably damaging	Het
Tmco3	T	A	8: 13,363,927 (GRCm39)	F83Y	probably damaging	Het
Trim25	T	C	11: 88,901,713 (GRCm39)	I336T	probably benign	Het
Ush2a	A	G	1: 188,643,170 (GRCm39)	I4177M	probably damaging	Het
Veph1	T	A	3: 66,162,458 (GRCm39)	T67S	probably damaging	Het
Vmn2r43	A	G	7: 8,258,125 (GRCm39)	F363L	probably benign	Het
Vps28	A	T	15: 76,506,871 (GRCm39)	I109N	probably damaging	Het
Vps50	A	G	6: 3,517,835 (GRCm39)	D91G	probably benign	Het
Wdr20	T	C	12: 110,760,133 (GRCm39)	F340L	probably benign	Het
Wdr95	A	G	5: 149,504,388 (GRCm39)		probably null	Het
Zfand6	A	G	7: 84,265,122 (GRCm39)	V193A	probably damaging	Het
Zfp703	C	A	8: 27,468,668 (GRCm39)	P111T	probably damaging	Het

Other mutations in Hsd11b2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00329:Hsd11b2	APN	8	106,249,759 (GRCm39)	missense	probably benign	0.06
IGL01620:Hsd11b2	APN	8	106,249,529 (GRCm39)	missense	probably benign	0.04
IGL02257:Hsd11b2	APN	8	106,249,854 (GRCm39)	missense	probably benign	0.04
IGL02655:Hsd11b2	APN	8	106,248,960 (GRCm39)	missense	probably benign	0.00
gilberto	UTSW	8	106,249,699 (GRCm39)	missense	possibly damaging	0.96
R0254:Hsd11b2	UTSW	8	106,249,699 (GRCm39)	missense	possibly damaging	0.96
R1082:Hsd11b2	UTSW	8	106,249,783 (GRCm39)	missense	probably damaging	0.99
R2050:Hsd11b2	UTSW	8	106,249,992 (GRCm39)	missense	probably benign	0.27
R4135:Hsd11b2	UTSW	8	106,249,798 (GRCm39)	missense	probably benign
R5294:Hsd11b2	UTSW	8	106,249,929 (GRCm39)	missense	probably benign	0.01
R5598:Hsd11b2	UTSW	8	106,249,143 (GRCm39)	missense	probably benign
R5780:Hsd11b2	UTSW	8	106,248,787 (GRCm39)	missense	probably damaging	1.00
R6058:Hsd11b2	UTSW	8	106,249,966 (GRCm39)	missense	possibly damaging	0.59
R7535:Hsd11b2	UTSW	8	106,245,755 (GRCm39)	missense	probably damaging	0.99
R7786:Hsd11b2	UTSW	8	106,245,506 (GRCm39)	missense	probably damaging	0.99
R8006:Hsd11b2	UTSW	8	106,245,735 (GRCm39)	missense	possibly damaging	0.95
R8110:Hsd11b2	UTSW	8	106,249,266 (GRCm39)	missense	probably damaging	0.98
R8889:Hsd11b2	UTSW	8	106,249,263 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCTTGGGCTGGAAATCCATTG -3'
(R):5'- AGGCCAGCGTTGTTAACCAG -3'

Sequencing Primer
(F):5'- TACCCTGGCTAGGTTGTGACAC -3'
(R):5'- GCGTTGTTAACCAGACCCC -3'

Posted On

2018-10-18