Incidental Mutation 'R6867:Gna13'
ID535988
Institutional Source Beutler Lab
Gene Symbol Gna13
Ensembl Gene ENSMUSG00000020611
Gene Nameguanine nucleotide binding protein, alpha 13
SynonymsGalpha13
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6867 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location109362831-109401369 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 109396122 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 257 (M257T)
Ref Sequence ENSEMBL: ENSMUSP00000020930 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020930]
PDB Structure
Crystal Structure of the p115RhoGEF rgRGS Domain in A Complex with Galpha(13):Galpha(i1) Chimera [X-RAY DIFFRACTION]
Crystal structure of G alpha 13 in complex with GDP [X-RAY DIFFRACTION]
Crystal structure of p115RhoGEF RGS domain in complex with G alpha 13 [X-RAY DIFFRACTION]
Crystal Structure of PDZRhoGEF rgRGS Domain in a Complex with Galpha-13 Bound to GDP [X-RAY DIFFRACTION]
Crystal Structure of PDZRhoGEF rgRGS Domain in a Complex with Galpha-13 Bound to GDP-AlF4 [X-RAY DIFFRACTION]
Crystal Structure of PDZRhoGEF rgRGS Domain in a Complex with Galpha-13 Bound to GTP-gamma-S [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020930
AA Change: M257T

PolyPhen 2 Score 0.840 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000020930
Gene: ENSMUSG00000020611
AA Change: M257T

DomainStartEndE-ValueType
G_alpha 28 376 5.28e-193 SMART
Meta Mutation Damage Score 0.148 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 100% (43/43)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted null or with an endothelial specific conditional mutation fail to develop an organized vascular system in the yolk sac, show impaired vascular development in some vascular beds in the embryo proper, and die during organogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik ACTGCACCACCT ACT 10: 43,532,725 probably benign Het
Apold1 T C 6: 134,984,056 S158P possibly damaging Het
Cep162 A T 9: 87,217,081 L788* probably null Het
Cyp7b1 T C 3: 18,097,230 Y273C probably damaging Het
Dlx1 C A 2: 71,531,009 N122K probably damaging Het
Dock10 A T 1: 80,531,259 I1605K probably damaging Het
Enox1 T C 14: 77,699,299 probably null Het
F3 T C 3: 121,729,371 S77P possibly damaging Het
Fam186a T A 15: 99,945,850 I838L unknown Het
Flrt2 T C 12: 95,779,382 F165L probably damaging Het
Gcgr T A 11: 120,536,469 V135E possibly damaging Het
Gm6741 T C 17: 91,236,911 L34P probably benign Het
Hsd11b2 G A 8: 105,522,317 R147H probably benign Het
Hydin A G 8: 110,539,802 Y2865C probably benign Het
Igdcc3 A G 9: 65,183,038 N610D probably damaging Het
Ipp T A 4: 116,510,409 probably null Het
Kdm5d A G Y: 927,425 T682A probably benign Het
Megf8 A G 7: 25,331,035 Y471C probably benign Het
Mprip T C 11: 59,749,630 probably null Het
Myrfl T A 10: 116,848,282 R179* probably null Het
Nek1 C A 8: 61,072,330 Q601K possibly damaging Het
Neurod4 C G 10: 130,270,714 K230N probably damaging Het
Olfr1037 A G 2: 86,085,738 I13T possibly damaging Het
Olfr374 C T 8: 72,109,863 T99I possibly damaging Het
Orc3 A G 4: 34,605,539 L114P probably damaging Het
Rag1 T C 2: 101,641,947 D950G probably damaging Het
Rasgrp2 G A 19: 6,413,183 S504N probably benign Het
Rgl2 A G 17: 33,932,687 D235G probably benign Het
Slc35e2 A G 4: 155,618,700 E390G probably benign Het
Slc39a1 T A 3: 90,249,452 V105E probably damaging Het
Tesk2 T A 4: 116,801,798 C291S probably damaging Het
Tmco3 T A 8: 13,313,927 F83Y probably damaging Het
Trim25 T C 11: 89,010,887 I336T probably benign Het
Ush2a A G 1: 188,910,973 I4177M probably damaging Het
Veph1 T A 3: 66,255,037 T67S probably damaging Het
Vmn2r43 A G 7: 8,255,126 F363L probably benign Het
Vps28 A T 15: 76,622,671 I109N probably damaging Het
Vps50 A G 6: 3,517,835 D91G probably benign Het
Wdr20 T C 12: 110,793,699 F340L probably benign Het
Wdr95 A G 5: 149,580,923 probably null Het
Zfand6 A G 7: 84,615,914 V193A probably damaging Het
Zfp703 C A 8: 26,978,640 P111T probably damaging Het
Other mutations in Gna13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01335:Gna13 APN 11 109365743 missense probably damaging 1.00
R2844:Gna13 UTSW 11 109363125 missense probably damaging 1.00
R4009:Gna13 UTSW 11 109396017 missense probably damaging 1.00
R4094:Gna13 UTSW 11 109396416 missense probably damaging 1.00
R4793:Gna13 UTSW 11 109363629 intron probably benign
R6525:Gna13 UTSW 11 109395939 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACAGCAAGATATCCTGCTTGC -3'
(R):5'- AACTTTTGGACGTCTCTTAAGCAG -3'

Sequencing Primer
(F):5'- AGATATCCTGCTTGCCAGAAG -3'
(R):5'- CTCTTAAGCAGTGGGGGTCC -3'
Posted On2018-10-18