Incidental Mutation 'R6867:Flrt2'
ID535990
Institutional Source Beutler Lab
Gene Symbol Flrt2
Ensembl Gene ENSMUSG00000047414
Gene Namefibronectin leucine rich transmembrane protein 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6867 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location95692226-95785215 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 95779382 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 165 (F165L)
Ref Sequence ENSEMBL: ENSMUSP00000105744 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057324] [ENSMUST00000110117]
PDB Structure
mouse FLRT2 LRR domain in complex with rat Unc5D Ig1 domain [X-RAY DIFFRACTION]
FLRT2 LRR domain [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000057324
AA Change: F165L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000062171
Gene: ENSMUSG00000047414
AA Change: F165L

DomainStartEndE-ValueType
LRRNT 35 67 1.51e-4 SMART
LRR 107 131 1.29e1 SMART
LRR 132 157 4.32e0 SMART
LRR 159 181 6.78e1 SMART
LRR 182 202 6.97e1 SMART
LRR 203 228 7.16e0 SMART
LRR 252 274 5.26e0 SMART
LRR_TYP 275 298 2.43e-4 SMART
LRRCT 310 361 1.17e-7 SMART
low complexity region 368 400 N/A INTRINSIC
FN3 420 502 5.07e0 SMART
transmembrane domain 542 564 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110117
AA Change: F165L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105744
Gene: ENSMUSG00000047414
AA Change: F165L

DomainStartEndE-ValueType
LRRNT 35 67 1.51e-4 SMART
LRR 107 131 1.29e1 SMART
LRR 132 157 4.32e0 SMART
LRR 159 181 6.78e1 SMART
LRR 182 202 6.97e1 SMART
LRR 203 228 7.16e0 SMART
LRR 252 274 5.26e0 SMART
LRR_TYP 275 298 2.43e-4 SMART
LRRCT 310 361 1.17e-7 SMART
low complexity region 368 400 N/A INTRINSIC
FN3 420 502 5.07e0 SMART
transmembrane domain 542 564 N/A INTRINSIC
Meta Mutation Damage Score 0.086 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the fibronectin leucine rich transmembrane (FLRT) family of cell adhesion molecules, which regulate early embryonic vascular and neural development. The encoded type I transmembrane protein has an extracellular region consisting of an N-terminal leucine-rich repeat domain and a type 3 fibronectin domain, followed by a transmembrane domain and a short C-terminal cytoplasmic tail domain. It functions as both a homophilic cell adhesion molecule and a heterophilic chemorepellent through its interaction with members of the uncoordinated-5 receptor family. Proteolytic removal of the extracellular region controls the migration of neurons in the developing cortex. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic, fetal, and postnatel lethality with few mice surviving to weaning due to defects in epicardium, myocardium, and endocardium development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik ACTGCACCACCT ACT 10: 43,532,725 probably benign Het
Apold1 T C 6: 134,984,056 S158P possibly damaging Het
Cep162 A T 9: 87,217,081 L788* probably null Het
Cyp7b1 T C 3: 18,097,230 Y273C probably damaging Het
Dlx1 C A 2: 71,531,009 N122K probably damaging Het
Dock10 A T 1: 80,531,259 I1605K probably damaging Het
Enox1 T C 14: 77,699,299 probably null Het
F3 T C 3: 121,729,371 S77P possibly damaging Het
Fam186a T A 15: 99,945,850 I838L unknown Het
Gcgr T A 11: 120,536,469 V135E possibly damaging Het
Gm6741 T C 17: 91,236,911 L34P probably benign Het
Gna13 T C 11: 109,396,122 M257T possibly damaging Het
Hsd11b2 G A 8: 105,522,317 R147H probably benign Het
Hydin A G 8: 110,539,802 Y2865C probably benign Het
Igdcc3 A G 9: 65,183,038 N610D probably damaging Het
Ipp T A 4: 116,510,409 probably null Het
Kdm5d A G Y: 927,425 T682A probably benign Het
Megf8 A G 7: 25,331,035 Y471C probably benign Het
Mprip T C 11: 59,749,630 probably null Het
Myrfl T A 10: 116,848,282 R179* probably null Het
Nek1 C A 8: 61,072,330 Q601K possibly damaging Het
Neurod4 C G 10: 130,270,714 K230N probably damaging Het
Olfr1037 A G 2: 86,085,738 I13T possibly damaging Het
Olfr374 C T 8: 72,109,863 T99I possibly damaging Het
Orc3 A G 4: 34,605,539 L114P probably damaging Het
Rag1 T C 2: 101,641,947 D950G probably damaging Het
Rasgrp2 G A 19: 6,413,183 S504N probably benign Het
Rgl2 A G 17: 33,932,687 D235G probably benign Het
Slc35e2 A G 4: 155,618,700 E390G probably benign Het
Slc39a1 T A 3: 90,249,452 V105E probably damaging Het
Tesk2 T A 4: 116,801,798 C291S probably damaging Het
Tmco3 T A 8: 13,313,927 F83Y probably damaging Het
Trim25 T C 11: 89,010,887 I336T probably benign Het
Ush2a A G 1: 188,910,973 I4177M probably damaging Het
Veph1 T A 3: 66,255,037 T67S probably damaging Het
Vmn2r43 A G 7: 8,255,126 F363L probably benign Het
Vps28 A T 15: 76,622,671 I109N probably damaging Het
Vps50 A G 6: 3,517,835 D91G probably benign Het
Wdr20 T C 12: 110,793,699 F340L probably benign Het
Wdr95 A G 5: 149,580,923 probably null Het
Zfand6 A G 7: 84,615,914 V193A probably damaging Het
Zfp703 C A 8: 26,978,640 P111T probably damaging Het
Other mutations in Flrt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00806:Flrt2 APN 12 95780529 missense probably damaging 1.00
IGL01083:Flrt2 APN 12 95780347 missense probably benign 0.05
IGL01410:Flrt2 APN 12 95779192 missense probably damaging 1.00
IGL01601:Flrt2 APN 12 95779595 missense probably damaging 0.99
IGL01800:Flrt2 APN 12 95779688 missense probably damaging 1.00
IGL01940:Flrt2 APN 12 95780238 missense probably damaging 1.00
IGL02224:Flrt2 APN 12 95780028 missense possibly damaging 0.58
IGL02272:Flrt2 APN 12 95779704 missense probably damaging 1.00
IGL02452:Flrt2 APN 12 95779483 missense probably benign 0.01
R0966:Flrt2 UTSW 12 95780301 missense possibly damaging 0.70
R1066:Flrt2 UTSW 12 95779059 missense probably damaging 1.00
R1218:Flrt2 UTSW 12 95778953 missense probably benign 0.00
R1442:Flrt2 UTSW 12 95780205 missense probably damaging 1.00
R1462:Flrt2 UTSW 12 95779338 missense probably damaging 1.00
R1462:Flrt2 UTSW 12 95779338 missense probably damaging 1.00
R1746:Flrt2 UTSW 12 95780792 missense possibly damaging 0.90
R1842:Flrt2 UTSW 12 95779284 missense probably damaging 1.00
R1901:Flrt2 UTSW 12 95779130 missense probably damaging 1.00
R1901:Flrt2 UTSW 12 95779131 missense probably damaging 1.00
R1959:Flrt2 UTSW 12 95780300 missense probably benign 0.01
R2310:Flrt2 UTSW 12 95780090 missense probably benign 0.01
R3418:Flrt2 UTSW 12 95780604 missense probably damaging 1.00
R3419:Flrt2 UTSW 12 95780604 missense probably damaging 1.00
R4412:Flrt2 UTSW 12 95780273 missense probably benign
R4617:Flrt2 UTSW 12 95780229 missense possibly damaging 0.96
R4674:Flrt2 UTSW 12 95780688 nonsense probably null
R5001:Flrt2 UTSW 12 95778951 missense probably benign
R5009:Flrt2 UTSW 12 95779773 missense probably damaging 0.98
R5150:Flrt2 UTSW 12 95779203 missense possibly damaging 0.84
R5179:Flrt2 UTSW 12 95780347 missense probably benign 0.05
R5269:Flrt2 UTSW 12 95779938 missense possibly damaging 0.46
R5535:Flrt2 UTSW 12 95780426 missense probably benign 0.08
R6172:Flrt2 UTSW 12 95779531 missense probably damaging 1.00
R6180:Flrt2 UTSW 12 95779238 nonsense probably null
R6986:Flrt2 UTSW 12 95780685 missense probably damaging 1.00
R7379:Flrt2 UTSW 12 95780555 missense possibly damaging 0.68
R7407:Flrt2 UTSW 12 95779300 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAACCAGTTGGATGAGTTCC -3'
(R):5'- GTGAGATGACTGAAGGTACCCTC -3'

Sequencing Primer
(F):5'- AACCAGTTGGATGAGTTCCCCATG -3'
(R):5'- TGACTGAAGGTACCCTCAGCAATG -3'
Posted On2018-10-18