Incidental Mutation 'R6867:Rgl2'
ID535995
Institutional Source Beutler Lab
Gene Symbol Rgl2
Ensembl Gene ENSMUSG00000041354
Gene Nameral guanine nucleotide dissociation stimulator-like 2
SynonymsKE1.5, Rab2l, Rgt2, Rlf
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock #R6867 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location33929543-33937687 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33932687 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 235 (D235G)
Ref Sequence ENSEMBL: ENSMUSP00000041082 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025161] [ENSMUST00000047503]
PDB Structure
STRUCTURE DETERMINATION OF THE RAS-BINDING DOMAIN OF THE RAL-SPECIFIC GUANINE NUCLEOTIDE EXCHANGE FACTOR RLF, NMR, 10 STRUCTURES [SOLUTION NMR]
The conformation of a docking site for SH3 domains is pre-selected in the Guanine Nucleotide Exchange Factor Rlf [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000025161
SMART Domains Protein: ENSMUSP00000025161
Gene: ENSMUSG00000024308

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 48 65 N/A INTRINSIC
low complexity region 127 152 N/A INTRINSIC
IG 168 292 3.45e0 SMART
IG_like 302 406 4.78e1 SMART
transmembrane domain 416 438 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000047503
AA Change: D235G

PolyPhen 2 Score 0.087 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000041082
Gene: ENSMUSG00000041354
AA Change: D235G

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 31 42 N/A INTRINSIC
low complexity region 44 63 N/A INTRINSIC
RasGEFN 87 212 9.54e-30 SMART
RasGEF 239 514 7.15e-106 SMART
low complexity region 578 592 N/A INTRINSIC
low complexity region 602 619 N/A INTRINSIC
low complexity region 633 648 N/A INTRINSIC
RA 649 736 2.05e-19 SMART
low complexity region 737 762 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173284
SMART Domains Protein: ENSMUSP00000134312
Gene: ENSMUSG00000041354

DomainStartEndE-ValueType
Blast:RasGEF 2 67 1e-35 BLAST
PDB:4JGW|B 2 67 1e-35 PDB
SCOP:d1bkds_ 2 94 3e-16 SMART
low complexity region 131 145 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 186 201 N/A INTRINSIC
RA 202 289 2.05e-19 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik ACTGCACCACCT ACT 10: 43,532,725 probably benign Het
Apold1 T C 6: 134,984,056 S158P possibly damaging Het
Cep162 A T 9: 87,217,081 L788* probably null Het
Cyp7b1 T C 3: 18,097,230 Y273C probably damaging Het
Dlx1 C A 2: 71,531,009 N122K probably damaging Het
Dock10 A T 1: 80,531,259 I1605K probably damaging Het
Enox1 T C 14: 77,699,299 probably null Het
F3 T C 3: 121,729,371 S77P possibly damaging Het
Fam186a T A 15: 99,945,850 I838L unknown Het
Flrt2 T C 12: 95,779,382 F165L probably damaging Het
Gcgr T A 11: 120,536,469 V135E possibly damaging Het
Gm6741 T C 17: 91,236,911 L34P probably benign Het
Gna13 T C 11: 109,396,122 M257T possibly damaging Het
Hsd11b2 G A 8: 105,522,317 R147H probably benign Het
Hydin A G 8: 110,539,802 Y2865C probably benign Het
Igdcc3 A G 9: 65,183,038 N610D probably damaging Het
Ipp T A 4: 116,510,409 probably null Het
Kdm5d A G Y: 927,425 T682A probably benign Het
Megf8 A G 7: 25,331,035 Y471C probably benign Het
Mprip T C 11: 59,749,630 probably null Het
Myrfl T A 10: 116,848,282 R179* probably null Het
Nek1 C A 8: 61,072,330 Q601K possibly damaging Het
Neurod4 C G 10: 130,270,714 K230N probably damaging Het
Olfr1037 A G 2: 86,085,738 I13T possibly damaging Het
Olfr374 C T 8: 72,109,863 T99I possibly damaging Het
Orc3 A G 4: 34,605,539 L114P probably damaging Het
Rag1 T C 2: 101,641,947 D950G probably damaging Het
Rasgrp2 G A 19: 6,413,183 S504N probably benign Het
Slc35e2 A G 4: 155,618,700 E390G probably benign Het
Slc39a1 T A 3: 90,249,452 V105E probably damaging Het
Tesk2 T A 4: 116,801,798 C291S probably damaging Het
Tmco3 T A 8: 13,313,927 F83Y probably damaging Het
Trim25 T C 11: 89,010,887 I336T probably benign Het
Ush2a A G 1: 188,910,973 I4177M probably damaging Het
Veph1 T A 3: 66,255,037 T67S probably damaging Het
Vmn2r43 A G 7: 8,255,126 F363L probably benign Het
Vps28 A T 15: 76,622,671 I109N probably damaging Het
Vps50 A G 6: 3,517,835 D91G probably benign Het
Wdr20 T C 12: 110,793,699 F340L probably benign Het
Wdr95 A G 5: 149,580,923 probably null Het
Zfand6 A G 7: 84,615,914 V193A probably damaging Het
Zfp703 C A 8: 26,978,640 P111T probably damaging Het
Other mutations in Rgl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Rgl2 APN 17 33933136 missense probably benign 0.31
IGL00898:Rgl2 APN 17 33933418 missense possibly damaging 0.95
IGL00965:Rgl2 APN 17 33935936 missense probably benign 0.00
IGL00985:Rgl2 APN 17 33932101 missense probably damaging 1.00
IGL02140:Rgl2 APN 17 33933124 missense probably damaging 1.00
IGL02214:Rgl2 APN 17 33935189 missense probably benign 0.06
IGL02486:Rgl2 APN 17 33935980 missense probably damaging 0.97
IGL02579:Rgl2 APN 17 33937160 missense probably benign 0.08
IGL02976:Rgl2 APN 17 33933962 missense possibly damaging 0.95
pedernales UTSW 17 33932038 critical splice acceptor site probably null
PIT4354001:Rgl2 UTSW 17 33933940 missense possibly damaging 0.80
R0347:Rgl2 UTSW 17 33932738 missense probably damaging 1.00
R0456:Rgl2 UTSW 17 33936849 splice site probably null
R0825:Rgl2 UTSW 17 33935159 splice site probably null
R1742:Rgl2 UTSW 17 33937223 unclassified probably null
R1777:Rgl2 UTSW 17 33931744 missense probably benign 0.00
R1829:Rgl2 UTSW 17 33933621 missense probably benign 0.00
R1908:Rgl2 UTSW 17 33932148 missense probably benign 0.00
R1961:Rgl2 UTSW 17 33933615 missense probably damaging 1.00
R2102:Rgl2 UTSW 17 33933340 splice site probably null
R3001:Rgl2 UTSW 17 33932605 missense probably benign 0.00
R3002:Rgl2 UTSW 17 33932605 missense probably benign 0.00
R3755:Rgl2 UTSW 17 33932597 missense probably benign 0.01
R3756:Rgl2 UTSW 17 33932597 missense probably benign 0.01
R3978:Rgl2 UTSW 17 33935162 missense probably benign 0.02
R4042:Rgl2 UTSW 17 33937262 missense probably damaging 1.00
R4064:Rgl2 UTSW 17 33937108 missense possibly damaging 0.77
R4204:Rgl2 UTSW 17 33936932 missense probably benign 0.04
R4661:Rgl2 UTSW 17 33933226 missense possibly damaging 0.77
R4852:Rgl2 UTSW 17 33937173 missense probably benign 0.00
R4922:Rgl2 UTSW 17 33932775 unclassified probably benign
R5119:Rgl2 UTSW 17 33937120 missense probably benign 0.00
R5167:Rgl2 UTSW 17 33935974 nonsense probably null
R5279:Rgl2 UTSW 17 33935948 missense probably benign
R5319:Rgl2 UTSW 17 33933555 missense probably benign 0.02
R5337:Rgl2 UTSW 17 33934984 missense probably damaging 0.99
R5881:Rgl2 UTSW 17 33932717 missense probably benign 0.01
R5945:Rgl2 UTSW 17 33932038 critical splice acceptor site probably null
R6165:Rgl2 UTSW 17 33931765 missense probably benign 0.01
R6358:Rgl2 UTSW 17 33937131 unclassified probably null
R7174:Rgl2 UTSW 17 33934990 missense possibly damaging 0.93
R7182:Rgl2 UTSW 17 33934990 missense possibly damaging 0.93
R7183:Rgl2 UTSW 17 33934990 missense possibly damaging 0.93
R7184:Rgl2 UTSW 17 33934990 missense possibly damaging 0.93
R7196:Rgl2 UTSW 17 33933429 missense probably damaging 1.00
R7203:Rgl2 UTSW 17 33933429 missense probably damaging 1.00
R7250:Rgl2 UTSW 17 33933429 missense probably damaging 1.00
R7253:Rgl2 UTSW 17 33934990 missense possibly damaging 0.93
R7254:Rgl2 UTSW 17 33934990 missense possibly damaging 0.93
R7255:Rgl2 UTSW 17 33934990 missense possibly damaging 0.93
R7256:Rgl2 UTSW 17 33934990 missense possibly damaging 0.93
R7282:Rgl2 UTSW 17 33933429 missense probably damaging 1.00
X0028:Rgl2 UTSW 17 33932458 unclassified probably null
Predicted Primers PCR Primer
(F):5'- CTCTGAGGTCAAGGGTCAAC -3'
(R):5'- TCTGAGGCTCTTAAGTGGCC -3'

Sequencing Primer
(F):5'- TCAACTTGACCGGCTTGAGAG -3'
(R):5'- TCTTAAGTGGCCAGGGACCAG -3'
Posted On2018-10-18