Incidental Mutation 'R6867:Rasgrp2'
ID535997
Institutional Source Beutler Lab
Gene Symbol Rasgrp2
Ensembl Gene ENSMUSG00000032946
Gene NameRAS, guanyl releasing protein 2
SynonymsCaldaggef1, CalDAG-GEFI
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6867 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location6399340-6415216 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 6413183 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 504 (S504N)
Ref Sequence ENSEMBL: ENSMUSP00000129873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035716] [ENSMUST00000113476] [ENSMUST00000127021] [ENSMUST00000167240]
Predicted Effect probably benign
Transcript: ENSMUST00000035716
AA Change: S504N

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000041135
Gene: ENSMUSG00000032946
AA Change: S504N

DomainStartEndE-ValueType
RasGEFN 3 126 3.56e-29 SMART
RasGEF 150 388 1.08e-100 SMART
EFh 430 458 8.25e-3 SMART
EFh 459 487 1.42e1 SMART
C1 499 548 3.22e-14 SMART
low complexity region 575 595 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113476
AA Change: S504N

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000109104
Gene: ENSMUSG00000032946
AA Change: S504N

DomainStartEndE-ValueType
RasGEFN 3 126 3.56e-29 SMART
RasGEF 150 388 1.08e-100 SMART
EFh 430 458 8.25e-3 SMART
EFh 459 487 1.42e1 SMART
C1 499 548 3.22e-14 SMART
low complexity region 575 595 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127021
SMART Domains Protein: ENSMUSP00000119740
Gene: ENSMUSG00000032946

DomainStartEndE-ValueType
Blast:RasGEFN 3 24 1e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000167240
AA Change: S504N

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000129873
Gene: ENSMUSG00000032946
AA Change: S504N

DomainStartEndE-ValueType
RasGEFN 3 126 3.56e-29 SMART
RasGEF 150 388 1.08e-100 SMART
EFh 430 458 8.25e-3 SMART
EFh 459 487 1.42e1 SMART
C1 499 548 3.22e-14 SMART
low complexity region 575 595 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a brain-enriched nucleotide exchanged factor that contains an N-terminal GEF domain, 2 tandem repeats of EF-hand calcium-binding motifs, and a C-terminal diacylglycerol/phorbol ester-binding domain. This protein can activate small GTPases, including RAS and RAP1/RAS3. The nucleotide exchange activity of this protein can be stimulated by calcium and diacylglycerol. Four alternatively spliced transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a knock-out allele do not undergo spontaneous hemorrhaging but exhibit impaired platelet aggregation, resistance to collagen-induced thrombosis, and increased bleeding times after tail transection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik ACTGCACCACCT ACT 10: 43,532,725 probably benign Het
Apold1 T C 6: 134,984,056 S158P possibly damaging Het
Cep162 A T 9: 87,217,081 L788* probably null Het
Cyp7b1 T C 3: 18,097,230 Y273C probably damaging Het
Dlx1 C A 2: 71,531,009 N122K probably damaging Het
Dock10 A T 1: 80,531,259 I1605K probably damaging Het
Enox1 T C 14: 77,699,299 probably null Het
F3 T C 3: 121,729,371 S77P possibly damaging Het
Fam186a T A 15: 99,945,850 I838L unknown Het
Flrt2 T C 12: 95,779,382 F165L probably damaging Het
Gcgr T A 11: 120,536,469 V135E possibly damaging Het
Gm6741 T C 17: 91,236,911 L34P probably benign Het
Gna13 T C 11: 109,396,122 M257T possibly damaging Het
Hsd11b2 G A 8: 105,522,317 R147H probably benign Het
Hydin A G 8: 110,539,802 Y2865C probably benign Het
Igdcc3 A G 9: 65,183,038 N610D probably damaging Het
Ipp T A 4: 116,510,409 probably null Het
Kdm5d A G Y: 927,425 T682A probably benign Het
Megf8 A G 7: 25,331,035 Y471C probably benign Het
Mprip T C 11: 59,749,630 probably null Het
Myrfl T A 10: 116,848,282 R179* probably null Het
Nek1 C A 8: 61,072,330 Q601K possibly damaging Het
Neurod4 C G 10: 130,270,714 K230N probably damaging Het
Olfr1037 A G 2: 86,085,738 I13T possibly damaging Het
Olfr374 C T 8: 72,109,863 T99I possibly damaging Het
Orc3 A G 4: 34,605,539 L114P probably damaging Het
Rag1 T C 2: 101,641,947 D950G probably damaging Het
Rgl2 A G 17: 33,932,687 D235G probably benign Het
Slc35e2 A G 4: 155,618,700 E390G probably benign Het
Slc39a1 T A 3: 90,249,452 V105E probably damaging Het
Tesk2 T A 4: 116,801,798 C291S probably damaging Het
Tmco3 T A 8: 13,313,927 F83Y probably damaging Het
Trim25 T C 11: 89,010,887 I336T probably benign Het
Ush2a A G 1: 188,910,973 I4177M probably damaging Het
Veph1 T A 3: 66,255,037 T67S probably damaging Het
Vmn2r43 A G 7: 8,255,126 F363L probably benign Het
Vps28 A T 15: 76,622,671 I109N probably damaging Het
Vps50 A G 6: 3,517,835 D91G probably benign Het
Wdr20 T C 12: 110,793,699 F340L probably benign Het
Wdr95 A G 5: 149,580,923 probably null Het
Zfand6 A G 7: 84,615,914 V193A probably damaging Het
Zfp703 C A 8: 26,978,640 P111T probably damaging Het
Other mutations in Rasgrp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01013:Rasgrp2 APN 19 6404383 missense probably damaging 1.00
IGL03053:Rasgrp2 APN 19 6407332 splice site probably benign
thither UTSW 19 6404727 missense probably damaging 1.00
R1593:Rasgrp2 UTSW 19 6403460 missense possibly damaging 0.77
R1604:Rasgrp2 UTSW 19 6407057 missense possibly damaging 0.62
R2016:Rasgrp2 UTSW 19 6413165 missense probably benign 0.01
R2017:Rasgrp2 UTSW 19 6413165 missense probably benign 0.01
R2119:Rasgrp2 UTSW 19 6404395 missense probably benign 0.00
R2120:Rasgrp2 UTSW 19 6404395 missense probably benign 0.00
R2122:Rasgrp2 UTSW 19 6404395 missense probably benign 0.00
R2124:Rasgrp2 UTSW 19 6404395 missense probably benign 0.00
R3879:Rasgrp2 UTSW 19 6413890 missense probably benign 0.07
R4049:Rasgrp2 UTSW 19 6404727 missense probably damaging 1.00
R4655:Rasgrp2 UTSW 19 6404846 intron probably benign
R5250:Rasgrp2 UTSW 19 6404313 missense probably damaging 1.00
R5320:Rasgrp2 UTSW 19 6408834 splice site probably null
R5620:Rasgrp2 UTSW 19 6405001 missense probably damaging 1.00
R5933:Rasgrp2 UTSW 19 6402513 missense probably damaging 1.00
R6155:Rasgrp2 UTSW 19 6402501 missense probably damaging 1.00
R6157:Rasgrp2 UTSW 19 6402501 missense probably damaging 1.00
R7237:Rasgrp2 UTSW 19 6404808 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- AGGTCCAAAGTCATGAGCTG -3'
(R):5'- AGGCCTGAGTTCTACATGTTCC -3'

Sequencing Primer
(F):5'- TCCAAAGTCATGAGCTGGGTGG -3'
(R):5'- AGTTCTACATGTTCCGCGGG -3'
Posted On2018-10-18