Incidental Mutation 'R6868:Ppp1r12b'
ID536000
Institutional Source Beutler Lab
Gene Symbol Ppp1r12b
Ensembl Gene ENSMUSG00000073557
Gene Nameprotein phosphatase 1, regulatory (inhibitor) subunit 12B
Synonyms9530009M10Rik, 1810037O03Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.304) question?
Stock #R6868 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location134754658-134955942 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 134886438 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 376 (T376A)
Ref Sequence ENSEMBL: ENSMUSP00000047463 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045665] [ENSMUST00000086444] [ENSMUST00000168381]
Predicted Effect probably benign
Transcript: ENSMUST00000045665
AA Change: T376A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000047463
Gene: ENSMUSG00000073557
AA Change: T376A

DomainStartEndE-ValueType
low complexity region 11 27 N/A INTRINSIC
ANK 56 86 8.36e1 SMART
ANK 90 119 5.32e-5 SMART
ANK 123 152 1.08e-5 SMART
ANK 216 245 1.51e-4 SMART
ANK 249 278 3.85e-2 SMART
low complexity region 351 379 N/A INTRINSIC
low complexity region 411 423 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
internal_repeat_3 539 576 2.45e-5 PROSPERO
PDB:2KJY|A 608 663 3e-12 PDB
internal_repeat_3 729 766 2.45e-5 PROSPERO
low complexity region 790 800 N/A INTRINSIC
low complexity region 840 864 N/A INTRINSIC
coiled coil region 867 974 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000086444
AA Change: T376A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000083633
Gene: ENSMUSG00000073557
AA Change: T376A

DomainStartEndE-ValueType
low complexity region 11 27 N/A INTRINSIC
ANK 56 86 8.36e1 SMART
ANK 90 119 5.32e-5 SMART
ANK 123 152 1.08e-5 SMART
ANK 216 245 1.51e-4 SMART
ANK 249 278 3.85e-2 SMART
low complexity region 351 379 N/A INTRINSIC
low complexity region 411 423 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
internal_repeat_3 539 576 1.9e-5 PROSPERO
PDB:2KJY|A 608 663 3e-12 PDB
internal_repeat_3 729 766 1.9e-5 PROSPERO
low complexity region 790 800 N/A INTRINSIC
low complexity region 840 864 N/A INTRINSIC
Pfam:PRKG1_interact 875 982 4.6e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168381
AA Change: T376A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000131406
Gene: ENSMUSG00000073557
AA Change: T376A

DomainStartEndE-ValueType
low complexity region 11 27 N/A INTRINSIC
ANK 56 86 8.36e1 SMART
ANK 90 119 5.32e-5 SMART
ANK 123 152 1.08e-5 SMART
ANK 216 245 1.51e-4 SMART
ANK 249 278 3.85e-2 SMART
low complexity region 351 379 N/A INTRINSIC
low complexity region 411 423 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
internal_repeat_3 539 576 1.9e-5 PROSPERO
PDB:2KJY|A 608 663 3e-12 PDB
internal_repeat_3 729 766 1.9e-5 PROSPERO
low complexity region 790 800 N/A INTRINSIC
low complexity region 840 864 N/A INTRINSIC
coiled coil region 867 986 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630010A05Rik A T 16: 14,618,695 N204I probably damaging Het
Aasdh C T 5: 76,891,680 V261M probably damaging Het
Adgrg7 A G 16: 56,773,476 F126L probably benign Het
Agxt2 T C 15: 10,373,769 L87P probably damaging Het
Alcam G A 16: 52,268,385 S554F probably damaging Het
Ambra1 T C 2: 91,917,533 S1205P possibly damaging Het
Bst2 A C 8: 71,534,760 V150G unknown Het
C3 T C 17: 57,204,029 Y1659C possibly damaging Het
Cacna1s G A 1: 136,092,694 R823Q probably benign Het
Cdk4 T C 10: 127,065,001 V174A probably benign Het
Ces2h T A 8: 105,018,423 N396K probably benign Het
Chd7 T C 4: 8,811,501 probably null Het
Cnih4 A G 1: 181,166,197 I76V probably null Het
Csmd2 G A 4: 128,442,840 V1404I probably benign Het
Ctrb1 T C 8: 111,689,403 D53G probably benign Het
Cul9 C A 17: 46,522,183 R1323L possibly damaging Het
Dchs1 A G 7: 105,763,503 V1230A possibly damaging Het
Dgat2 T C 7: 99,158,306 D219G probably benign Het
Dgkh T C 14: 78,624,853 T225A probably damaging Het
Dock9 G T 14: 121,586,264 A1412E probably benign Het
Dscam C T 16: 96,829,940 V292M probably damaging Het
Fam183b C T 11: 58,792,906 D113N probably damaging Het
Fras1 T A 5: 96,682,378 V1509E probably benign Het
Fryl T C 5: 73,068,803 Q1839R probably damaging Het
Gcat A G 15: 79,035,366 D177G probably damaging Het
Gss T C 2: 155,567,812 T235A possibly damaging Het
Ints10 T A 8: 68,797,798 M114K probably damaging Het
Ints5 T G 19: 8,897,386 L903R probably damaging Het
Lipo2 G T 19: 33,748,462 P130Q possibly damaging Het
Megf11 G A 9: 64,680,309 C494Y probably damaging Het
Milr1 T C 11: 106,763,921 Y162H probably damaging Het
Mrc2 T A 11: 105,328,418 I278N probably damaging Het
Mst1r T A 9: 107,915,933 probably null Het
Myh15 G A 16: 49,069,403 C119Y probably damaging Het
Nap1l1 G A 10: 111,494,808 G358D probably damaging Het
Nav3 T C 10: 109,693,166 I2178V possibly damaging Het
Nkx2-5 T C 17: 26,841,294 E21G probably damaging Het
Nos2 C T 11: 78,957,506 R967C probably benign Het
Olfr811 T C 10: 129,802,168 D119G probably damaging Het
Parp10 T C 15: 76,243,106 R44G probably damaging Het
Pced1b A G 15: 97,384,341 H87R probably damaging Het
Ppfia3 T A 7: 45,353,612 L524F probably damaging Het
Ppp4r4 T C 12: 103,590,852 L449P probably damaging Het
Prkd1 T C 12: 50,425,537 R198G probably damaging Het
Pth2r C A 1: 65,388,479 A437E probably benign Het
Ptprh A T 7: 4,601,865 I60N probably benign Het
Pxmp2 C T 5: 110,285,980 R9Q probably damaging Het
Scarb2 T C 5: 92,485,309 K55E probably benign Het
Slc18b1 T C 10: 23,804,234 V109A possibly damaging Het
Slx4ip T A 2: 137,000,210 D18E probably damaging Het
Stk40 A G 4: 126,123,814 R45G probably damaging Het
Tbxas1 A T 6: 39,084,306 Q513L probably damaging Het
Tcf4 A T 18: 69,657,650 probably null Het
Tmc6 T A 11: 117,774,317 I377F probably benign Het
Tmem131l T C 3: 83,961,631 I146V probably damaging Het
Trac T A 14: 54,220,592 probably benign Het
Trpm7 T C 2: 126,837,414 D409G probably damaging Het
Usp39 A T 6: 72,337,751 V224E possibly damaging Het
Vmn1r184 A C 7: 26,267,302 M158L probably benign Het
Vmn2r120 T A 17: 57,545,218 I33L probably benign Het
Other mutations in Ppp1r12b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01358:Ppp1r12b APN 1 134892159 missense probably damaging 1.00
IGL01788:Ppp1r12b APN 1 134893507 missense possibly damaging 0.66
IGL01880:Ppp1r12b APN 1 134886421 critical splice donor site probably null
IGL02109:Ppp1r12b APN 1 134872805 critical splice donor site probably null
IGL02247:Ppp1r12b APN 1 134835983 missense probably benign
IGL02336:Ppp1r12b APN 1 134886506 missense probably damaging 1.00
IGL02903:Ppp1r12b APN 1 134955649 missense probably benign
IGL02963:Ppp1r12b APN 1 134886548 missense probably damaging 1.00
IGL03074:Ppp1r12b APN 1 134836020 missense probably benign 0.01
IGL03302:Ppp1r12b APN 1 134838050 splice site probably benign
R0102:Ppp1r12b UTSW 1 134835899 critical splice acceptor site probably null
R0102:Ppp1r12b UTSW 1 134835899 critical splice acceptor site probably null
R0189:Ppp1r12b UTSW 1 134865776 critical splice donor site probably null
R0556:Ppp1r12b UTSW 1 134777322 missense probably damaging 1.00
R0594:Ppp1r12b UTSW 1 134776479 missense probably damaging 1.00
R0690:Ppp1r12b UTSW 1 134876082 missense probably damaging 1.00
R1354:Ppp1r12b UTSW 1 134835983 missense probably benign 0.42
R1676:Ppp1r12b UTSW 1 134777452 missense probably damaging 1.00
R1775:Ppp1r12b UTSW 1 134893348 critical splice donor site probably null
R1839:Ppp1r12b UTSW 1 134837981 missense probably benign 0.32
R1946:Ppp1r12b UTSW 1 134892270 missense probably damaging 1.00
R1971:Ppp1r12b UTSW 1 134865913 missense probably benign 0.00
R1997:Ppp1r12b UTSW 1 134846355 intron probably benign
R3110:Ppp1r12b UTSW 1 134872832 missense probably damaging 1.00
R3112:Ppp1r12b UTSW 1 134872832 missense probably damaging 1.00
R3908:Ppp1r12b UTSW 1 134842732 missense probably damaging 1.00
R3912:Ppp1r12b UTSW 1 134887318 missense probably damaging 1.00
R3977:Ppp1r12b UTSW 1 134765975 missense probably benign 0.00
R4243:Ppp1r12b UTSW 1 134782108 intron probably benign
R4835:Ppp1r12b UTSW 1 134955733 missense probably benign 0.21
R4836:Ppp1r12b UTSW 1 134955733 missense probably benign 0.21
R4843:Ppp1r12b UTSW 1 134955733 missense probably benign 0.21
R4854:Ppp1r12b UTSW 1 134873951 missense probably damaging 1.00
R4870:Ppp1r12b UTSW 1 134949033 missense probably benign 0.00
R4881:Ppp1r12b UTSW 1 134955733 missense probably benign 0.21
R5024:Ppp1r12b UTSW 1 134955733 missense probably benign 0.21
R5054:Ppp1r12b UTSW 1 134955733 missense probably benign 0.21
R5055:Ppp1r12b UTSW 1 134955733 missense probably benign 0.21
R5056:Ppp1r12b UTSW 1 134834392 intron probably benign
R5056:Ppp1r12b UTSW 1 134955733 missense probably benign 0.21
R5158:Ppp1r12b UTSW 1 134886428 missense probably damaging 1.00
R5599:Ppp1r12b UTSW 1 134865907 missense probably benign 0.08
R5771:Ppp1r12b UTSW 1 134773424 critical splice donor site probably null
R5775:Ppp1r12b UTSW 1 134876042 missense probably benign
R5872:Ppp1r12b UTSW 1 134776406 missense probably benign 0.03
R5896:Ppp1r12b UTSW 1 134765981 missense probably damaging 1.00
R6060:Ppp1r12b UTSW 1 134955524 missense possibly damaging 0.82
R6129:Ppp1r12b UTSW 1 134892252 nonsense probably null
R6369:Ppp1r12b UTSW 1 134886542 missense possibly damaging 0.93
X0022:Ppp1r12b UTSW 1 134835873 missense probably benign 0.00
X0027:Ppp1r12b UTSW 1 134896354 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATGGCTGTGTCAGAACTGG -3'
(R):5'- ACTGTAGAAAAGCCAAGGTCC -3'

Sequencing Primer
(F):5'- CTGGCAGGTATATTTTAACTGAGCTC -3'
(R):5'- GCACACAGAGATAAGAAGGATCTTCC -3'
Posted On2018-10-18