Incidental Mutation 'R6869:Olfr1107'
ID536063
Institutional Source Beutler Lab
Gene Symbol Olfr1107
Ensembl Gene ENSMUSG00000075163
Gene Nameolfactory receptor 1107
SynonymsGA_x6K02T2Q125-48565383-48564445, MOR172-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R6869 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location87068671-87075817 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 87071673 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 154 (I154F)
Ref Sequence ENSEMBL: ENSMUSP00000150135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099865] [ENSMUST00000214049]
Predicted Effect probably benign
Transcript: ENSMUST00000099865
AA Change: I154F

PolyPhen 2 Score 0.110 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000097450
Gene: ENSMUSG00000075163
AA Change: I154F

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.9e-53 PFAM
Pfam:7tm_1 41 290 1.9e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214049
AA Change: I154F

PolyPhen 2 Score 0.110 (Sensitivity: 0.93; Specificity: 0.86)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 97% (61/63)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankdd1b A T 13: 96,444,291 N166K possibly damaging Het
Arhgap30 G T 1: 171,409,055 R999L probably damaging Het
Bnc2 T A 4: 84,293,496 D212V probably damaging Het
Bpifb5 T C 2: 154,233,223 I357T probably benign Het
Catsperb T C 12: 101,480,737 F208S probably benign Het
Cc2d2b T A 19: 40,809,454 H1105Q probably benign Het
Chchd6 T C 6: 89,595,496 D17G probably damaging Het
Chd6 T C 2: 160,965,730 S1855G probably benign Het
Cpe A G 8: 64,619,427 V143A probably benign Het
Cyfip1 T A 7: 55,907,365 V770D possibly damaging Het
Cyp1a1 A T 9: 57,702,784 M494L probably benign Het
Dcstamp T C 15: 39,754,458 S88P probably damaging Het
Dnah2 T A 11: 69,429,471 N3924I probably damaging Het
F830045P16Rik T C 2: 129,474,561 E76G probably damaging Het
Fam91a1 T A 15: 58,431,268 V342E probably benign Het
Fastkd1 G A 2: 69,702,760 A421V probably benign Het
Fgf20 T C 8: 40,281,148 Y64C probably damaging Het
Gen1 A T 12: 11,241,441 N847K probably benign Het
Gm438 A T 4: 144,780,472 probably null Het
Gm4922 A T 10: 18,784,515 I153K probably damaging Het
Gm6619 T C 6: 131,486,438 I6T unknown Het
H2-Ab1 T C 17: 34,267,563 Y199H probably damaging Het
Hdac7 C A 15: 97,796,176 L737F probably damaging Het
Hells A G 19: 38,940,635 N121D probably benign Het
Itga2 G A 13: 114,875,537 probably null Het
Itgb1 A G 8: 128,720,035 D391G probably benign Het
Lama5 G A 2: 180,191,662 P1519L probably damaging Het
Lbx1 T A 19: 45,234,951 S93C probably damaging Het
Lmod2 T C 6: 24,604,127 M367T probably benign Het
Lrrc43 G A 5: 123,504,276 probably null Het
Man2a2 C T 7: 80,362,945 G574D probably benign Het
Mier2 T G 10: 79,542,669 K343T probably damaging Het
Msh5 A T 17: 35,041,834 probably null Het
Mtus1 T C 8: 41,082,654 Q675R possibly damaging Het
Ncan A T 8: 70,107,907 H803Q probably benign Het
Nckap5l A G 15: 99,426,453 V723A probably damaging Het
Nectin3 G A 16: 46,395,143 R79C probably damaging Het
Nlrc5 A G 8: 94,521,955 E1735G probably benign Het
Nrros A G 16: 32,144,431 L220S probably damaging Het
Olfr584 G A 7: 103,085,868 V112M possibly damaging Het
Oxa1l C T 14: 54,366,738 P152S probably damaging Het
Pdcd6ip A G 9: 113,655,106 Y818H unknown Het
Pik3cb A T 9: 99,060,259 S682T probably benign Het
Ppp1r3a A C 6: 14,754,826 S141A probably benign Het
Prrc2c TTGCTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGCTGCTGC 1: 162,709,061 probably benign Het
Ptprk T C 10: 28,473,059 probably null Het
Ranbp17 T C 11: 33,513,074 probably benign Het
Rcbtb1 T C 14: 59,217,602 V95A probably benign Het
Retreg3 G A 11: 101,119,818 probably benign Het
Rhobtb1 T C 10: 69,270,226 L207P probably damaging Het
Rsf1 GGCG GGCGACGGCTGCG 7: 97,579,906 probably benign Het
Sh3bgr A G 16: 96,206,660 Y75C probably damaging Het
Strip1 T C 3: 107,613,445 D763G probably damaging Het
Stxbp5l A T 16: 37,204,448 V596E possibly damaging Het
Tas2r138 A G 6: 40,612,421 I297T probably damaging Het
Topors A C 4: 40,261,201 N694K unknown Het
Tymp T C 15: 89,376,691 R20G probably benign Het
Ubr4 A G 4: 139,467,227 T1144A possibly damaging Het
Unc79 A T 12: 103,113,072 Q1636L probably benign Het
Vmn1r78 A G 7: 12,152,749 M96V probably benign Het
Wfdc8 C T 2: 164,599,092 D244N possibly damaging Het
Zbtb49 G T 5: 38,214,350 N62K probably damaging Het
Zfp579 G T 7: 4,994,461 D150E probably benign Het
Other mutations in Olfr1107
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00905:Olfr1107 APN 2 87071219 missense probably benign 0.00
IGL01521:Olfr1107 APN 2 87071733 missense probably benign 0.11
IGL03350:Olfr1107 APN 2 87071560 missense probably damaging 1.00
PIT4791001:Olfr1107 UTSW 2 87071702 missense possibly damaging 0.94
R0801:Olfr1107 UTSW 2 87072063 nonsense probably null
R1383:Olfr1107 UTSW 2 87071792 missense probably damaging 1.00
R1577:Olfr1107 UTSW 2 87071397 missense probably benign 0.15
R1762:Olfr1107 UTSW 2 87071921 missense probably damaging 1.00
R2027:Olfr1107 UTSW 2 87071553 missense possibly damaging 0.85
R3850:Olfr1107 UTSW 2 87071966 missense possibly damaging 0.89
R5345:Olfr1107 UTSW 2 87071492 missense possibly damaging 0.61
R5409:Olfr1107 UTSW 2 87071870 missense possibly damaging 0.64
R5451:Olfr1107 UTSW 2 87071997 missense probably damaging 1.00
R5735:Olfr1107 UTSW 2 87071412 missense probably damaging 1.00
R6091:Olfr1107 UTSW 2 87071361 missense probably benign 0.03
R7080:Olfr1107 UTSW 2 87071739 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCGGATTCTCAGGATGGCAATG -3'
(R):5'- AAGTCTAGCACATTCTTTGGCTG -3'

Sequencing Primer
(F):5'- TCTCAGGATGGCAATGATAATATGG -3'
(R):5'- AGCACATTCTTTGGCTGTGTTC -3'
Posted On2018-10-18