Incidental Mutation 'R6869:Lmod2'
ID536077
Institutional Source Beutler Lab
Gene Symbol Lmod2
Ensembl Gene ENSMUSG00000029683
Gene Nameleiomodin 2 (cardiac)
SynonymsC-Lmod
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R6869 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location24597762-24605414 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24604127 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 367 (M367T)
Ref Sequence ENSEMBL: ENSMUSP00000031694 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031694]
Predicted Effect probably benign
Transcript: ENSMUST00000031694
AA Change: M367T

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000031694
Gene: ENSMUSG00000029683
AA Change: M367T

DomainStartEndE-ValueType
Pfam:Tropomodulin 6 153 9.7e-19 PFAM
PDB:1IO0|A 202 360 5e-45 PDB
low complexity region 361 374 N/A INTRINSIC
low complexity region 403 414 N/A INTRINSIC
low complexity region 421 453 N/A INTRINSIC
low complexity region 482 490 N/A INTRINSIC
Meta Mutation Damage Score 0.1416 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 97% (61/63)
MGI Phenotype PHENOTYPE: Homozygous disruption of this gene results in thin filaments in the heart, cardiac contractile dysfunction, abnormal myocardial fiber ultrastucture, dilated cardiomyopathy, and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankdd1b A T 13: 96,444,291 N166K possibly damaging Het
Arhgap30 G T 1: 171,409,055 R999L probably damaging Het
Bnc2 T A 4: 84,293,496 D212V probably damaging Het
Bpifb5 T C 2: 154,233,223 I357T probably benign Het
Catsperb T C 12: 101,480,737 F208S probably benign Het
Cc2d2b T A 19: 40,809,454 H1105Q probably benign Het
Chchd6 T C 6: 89,595,496 D17G probably damaging Het
Chd6 T C 2: 160,965,730 S1855G probably benign Het
Cpe A G 8: 64,619,427 V143A probably benign Het
Cyfip1 T A 7: 55,907,365 V770D possibly damaging Het
Cyp1a1 A T 9: 57,702,784 M494L probably benign Het
Dcstamp T C 15: 39,754,458 S88P probably damaging Het
Dnah2 T A 11: 69,429,471 N3924I probably damaging Het
F830045P16Rik T C 2: 129,474,561 E76G probably damaging Het
Fam91a1 T A 15: 58,431,268 V342E probably benign Het
Fastkd1 G A 2: 69,702,760 A421V probably benign Het
Fgf20 T C 8: 40,281,148 Y64C probably damaging Het
Gen1 A T 12: 11,241,441 N847K probably benign Het
Gm438 A T 4: 144,780,472 probably null Het
Gm4922 A T 10: 18,784,515 I153K probably damaging Het
Gm6619 T C 6: 131,486,438 I6T unknown Het
H2-Ab1 T C 17: 34,267,563 Y199H probably damaging Het
Hdac7 C A 15: 97,796,176 L737F probably damaging Het
Hells A G 19: 38,940,635 N121D probably benign Het
Itga2 G A 13: 114,875,537 probably null Het
Itgb1 A G 8: 128,720,035 D391G probably benign Het
Lama5 G A 2: 180,191,662 P1519L probably damaging Het
Lbx1 T A 19: 45,234,951 S93C probably damaging Het
Lrrc43 G A 5: 123,504,276 probably null Het
Man2a2 C T 7: 80,362,945 G574D probably benign Het
Mier2 T G 10: 79,542,669 K343T probably damaging Het
Msh5 A T 17: 35,041,834 probably null Het
Mtus1 T C 8: 41,082,654 Q675R possibly damaging Het
Ncan A T 8: 70,107,907 H803Q probably benign Het
Nckap5l A G 15: 99,426,453 V723A probably damaging Het
Nectin3 G A 16: 46,395,143 R79C probably damaging Het
Nlrc5 A G 8: 94,521,955 E1735G probably benign Het
Nrros A G 16: 32,144,431 L220S probably damaging Het
Olfr1107 T A 2: 87,071,673 I154F probably benign Het
Olfr584 G A 7: 103,085,868 V112M possibly damaging Het
Oxa1l C T 14: 54,366,738 P152S probably damaging Het
Pdcd6ip A G 9: 113,655,106 Y818H unknown Het
Pik3cb A T 9: 99,060,259 S682T probably benign Het
Ppp1r3a A C 6: 14,754,826 S141A probably benign Het
Prrc2c TTGCTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGCTGCTGC 1: 162,709,061 probably benign Het
Ptprk T C 10: 28,473,059 probably null Het
Ranbp17 T C 11: 33,513,074 probably benign Het
Rcbtb1 T C 14: 59,217,602 V95A probably benign Het
Retreg3 G A 11: 101,119,818 probably benign Het
Rhobtb1 T C 10: 69,270,226 L207P probably damaging Het
Rsf1 GGCG GGCGACGGCTGCG 7: 97,579,906 probably benign Het
Sh3bgr A G 16: 96,206,660 Y75C probably damaging Het
Strip1 T C 3: 107,613,445 D763G probably damaging Het
Stxbp5l A T 16: 37,204,448 V596E possibly damaging Het
Tas2r138 A G 6: 40,612,421 I297T probably damaging Het
Topors A C 4: 40,261,201 N694K unknown Het
Tymp T C 15: 89,376,691 R20G probably benign Het
Ubr4 A G 4: 139,467,227 T1144A possibly damaging Het
Unc79 A T 12: 103,113,072 Q1636L probably benign Het
Vmn1r78 A G 7: 12,152,749 M96V probably benign Het
Wfdc8 C T 2: 164,599,092 D244N possibly damaging Het
Zbtb49 G T 5: 38,214,350 N62K probably damaging Het
Zfp579 G T 7: 4,994,461 D150E probably benign Het
Other mutations in Lmod2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Lmod2 APN 6 24598052 missense probably damaging 1.00
IGL01013:Lmod2 APN 6 24604135 missense probably damaging 0.98
IGL02164:Lmod2 APN 6 24603910 missense possibly damaging 0.89
IGL02328:Lmod2 APN 6 24603833 missense probably benign 0.00
IGL02956:Lmod2 APN 6 24603632 missense probably damaging 1.00
IGL03213:Lmod2 APN 6 24603616 missense possibly damaging 0.88
IGL03351:Lmod2 APN 6 24598016 missense probably benign 0.00
P0035:Lmod2 UTSW 6 24597886 missense probably damaging 1.00
R1764:Lmod2 UTSW 6 24603377 missense probably damaging 0.99
R3104:Lmod2 UTSW 6 24604472 missense probably damaging 1.00
R3955:Lmod2 UTSW 6 24603871 missense probably benign 0.02
R4410:Lmod2 UTSW 6 24604630 missense probably damaging 1.00
R4876:Lmod2 UTSW 6 24604279 missense probably benign 0.06
R4957:Lmod2 UTSW 6 24603872 missense possibly damaging 0.63
R5509:Lmod2 UTSW 6 24603889 missense probably damaging 1.00
R5655:Lmod2 UTSW 6 24603854 missense possibly damaging 0.65
R6114:Lmod2 UTSW 6 24603692 missense probably damaging 1.00
R6462:Lmod2 UTSW 6 24604301 missense probably benign 0.06
R6834:Lmod2 UTSW 6 24597783 start gained probably benign
R6909:Lmod2 UTSW 6 24604158 missense probably benign 0.00
R6918:Lmod2 UTSW 6 24603595 missense probably benign 0.23
R7352:Lmod2 UTSW 6 24598111 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- GATCCTGGCCATCATGAGAG -3'
(R):5'- CTGTCCATTTTGTAGGGCGC -3'

Sequencing Primer
(F):5'- ATCATGAGAGCCCTGCAGC -3'
(R):5'- AATGACTTCTGCAATGTTTCTGG -3'
Posted On2018-10-18