Incidental Mutation 'R6869:Zfp579'
ID536080
Institutional Source Beutler Lab
Gene Symbol Zfp579
Ensembl Gene ENSMUSG00000051550
Gene Namezinc finger protein 579
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6869 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location4983483-4996158 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 4994461 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 150 (D150E)
Ref Sequence ENSEMBL: ENSMUSP00000123963 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108572] [ENSMUST00000162502] [ENSMUST00000162731]
Predicted Effect probably benign
Transcript: ENSMUST00000108572
AA Change: D150E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000104212
Gene: ENSMUSG00000051550
AA Change: D150E

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 16 44 N/A INTRINSIC
ZnF_C2H2 46 68 8.09e-1 SMART
ZnF_C2H2 74 96 2.4e-3 SMART
ZnF_C2H2 102 125 3.83e-2 SMART
low complexity region 157 170 N/A INTRINSIC
low complexity region 189 216 N/A INTRINSIC
low complexity region 250 262 N/A INTRINSIC
ZnF_C2H2 267 289 1.36e-2 SMART
ZnF_C2H2 295 317 5.14e-3 SMART
low complexity region 318 368 N/A INTRINSIC
ZnF_C2H2 382 404 4.34e0 SMART
ZnF_C2H2 410 432 5.06e-2 SMART
ZnF_C2H2 439 461 1.92e-2 SMART
low complexity region 462 492 N/A INTRINSIC
low complexity region 511 525 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162502
AA Change: D150E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000124074
Gene: ENSMUSG00000051550
AA Change: D150E

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 16 44 N/A INTRINSIC
ZnF_C2H2 46 68 8.09e-1 SMART
ZnF_C2H2 74 96 2.4e-3 SMART
ZnF_C2H2 102 125 3.83e-2 SMART
low complexity region 157 170 N/A INTRINSIC
coiled coil region 190 213 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162731
AA Change: D150E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000123963
Gene: ENSMUSG00000051550
AA Change: D150E

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 16 44 N/A INTRINSIC
ZnF_C2H2 46 68 8.09e-1 SMART
ZnF_C2H2 74 96 2.4e-3 SMART
ZnF_C2H2 102 125 3.83e-2 SMART
low complexity region 157 170 N/A INTRINSIC
low complexity region 189 216 N/A INTRINSIC
low complexity region 250 262 N/A INTRINSIC
ZnF_C2H2 267 289 1.36e-2 SMART
ZnF_C2H2 295 317 5.14e-3 SMART
low complexity region 318 368 N/A INTRINSIC
ZnF_C2H2 382 404 4.34e0 SMART
ZnF_C2H2 410 432 5.06e-2 SMART
ZnF_C2H2 439 461 1.92e-2 SMART
low complexity region 462 492 N/A INTRINSIC
low complexity region 511 525 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 97% (61/63)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankdd1b A T 13: 96,444,291 N166K possibly damaging Het
Arhgap30 G T 1: 171,409,055 R999L probably damaging Het
Bnc2 T A 4: 84,293,496 D212V probably damaging Het
Bpifb5 T C 2: 154,233,223 I357T probably benign Het
Catsperb T C 12: 101,480,737 F208S probably benign Het
Cc2d2b T A 19: 40,809,454 H1105Q probably benign Het
Chchd6 T C 6: 89,595,496 D17G probably damaging Het
Chd6 T C 2: 160,965,730 S1855G probably benign Het
Cpe A G 8: 64,619,427 V143A probably benign Het
Cyfip1 T A 7: 55,907,365 V770D possibly damaging Het
Cyp1a1 A T 9: 57,702,784 M494L probably benign Het
Dcstamp T C 15: 39,754,458 S88P probably damaging Het
Dnah2 T A 11: 69,429,471 N3924I probably damaging Het
F830045P16Rik T C 2: 129,474,561 E76G probably damaging Het
Fam91a1 T A 15: 58,431,268 V342E probably benign Het
Fastkd1 G A 2: 69,702,760 A421V probably benign Het
Fgf20 T C 8: 40,281,148 Y64C probably damaging Het
Gen1 A T 12: 11,241,441 N847K probably benign Het
Gm438 A T 4: 144,780,472 probably null Het
Gm4922 A T 10: 18,784,515 I153K probably damaging Het
Gm6619 T C 6: 131,486,438 I6T unknown Het
H2-Ab1 T C 17: 34,267,563 Y199H probably damaging Het
Hdac7 C A 15: 97,796,176 L737F probably damaging Het
Hells A G 19: 38,940,635 N121D probably benign Het
Itga2 G A 13: 114,875,537 probably null Het
Itgb1 A G 8: 128,720,035 D391G probably benign Het
Lama5 G A 2: 180,191,662 P1519L probably damaging Het
Lbx1 T A 19: 45,234,951 S93C probably damaging Het
Lmod2 T C 6: 24,604,127 M367T probably benign Het
Lrrc43 G A 5: 123,504,276 probably null Het
Man2a2 C T 7: 80,362,945 G574D probably benign Het
Mier2 T G 10: 79,542,669 K343T probably damaging Het
Msh5 A T 17: 35,041,834 probably null Het
Mtus1 T C 8: 41,082,654 Q675R possibly damaging Het
Ncan A T 8: 70,107,907 H803Q probably benign Het
Nckap5l A G 15: 99,426,453 V723A probably damaging Het
Nectin3 G A 16: 46,395,143 R79C probably damaging Het
Nlrc5 A G 8: 94,521,955 E1735G probably benign Het
Nrros A G 16: 32,144,431 L220S probably damaging Het
Olfr1107 T A 2: 87,071,673 I154F probably benign Het
Olfr584 G A 7: 103,085,868 V112M possibly damaging Het
Oxa1l C T 14: 54,366,738 P152S probably damaging Het
Pdcd6ip A G 9: 113,655,106 Y818H unknown Het
Pik3cb A T 9: 99,060,259 S682T probably benign Het
Ppp1r3a A C 6: 14,754,826 S141A probably benign Het
Prrc2c TTGCTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGCTGCTGC 1: 162,709,061 probably benign Het
Ptprk T C 10: 28,473,059 probably null Het
Ranbp17 T C 11: 33,513,074 probably benign Het
Rcbtb1 T C 14: 59,217,602 V95A probably benign Het
Retreg3 G A 11: 101,119,818 probably benign Het
Rhobtb1 T C 10: 69,270,226 L207P probably damaging Het
Rsf1 GGCG GGCGACGGCTGCG 7: 97,579,906 probably benign Het
Sh3bgr A G 16: 96,206,660 Y75C probably damaging Het
Strip1 T C 3: 107,613,445 D763G probably damaging Het
Stxbp5l A T 16: 37,204,448 V596E possibly damaging Het
Tas2r138 A G 6: 40,612,421 I297T probably damaging Het
Topors A C 4: 40,261,201 N694K unknown Het
Tymp T C 15: 89,376,691 R20G probably benign Het
Ubr4 A G 4: 139,467,227 T1144A possibly damaging Het
Unc79 A T 12: 103,113,072 Q1636L probably benign Het
Vmn1r78 A G 7: 12,152,749 M96V probably benign Het
Wfdc8 C T 2: 164,599,092 D244N possibly damaging Het
Zbtb49 G T 5: 38,214,350 N62K probably damaging Het
Other mutations in Zfp579
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00971:Zfp579 APN 7 4993391 missense probably damaging 0.97
IGL01121:Zfp579 APN 7 4993247 missense possibly damaging 0.59
IGL01475:Zfp579 APN 7 4994744 missense probably benign 0.32
IGL01866:Zfp579 APN 7 4994258 missense possibly damaging 0.88
IGL02284:Zfp579 APN 7 4994168 missense probably damaging 0.99
IGL02313:Zfp579 APN 7 4994433 missense probably benign 0.23
R1803:Zfp579 UTSW 7 4993770 missense probably damaging 1.00
R2025:Zfp579 UTSW 7 4993521 nonsense probably null
R2026:Zfp579 UTSW 7 4993521 nonsense probably null
R2027:Zfp579 UTSW 7 4993521 nonsense probably null
R3690:Zfp579 UTSW 7 4994720 missense probably damaging 0.99
R4303:Zfp579 UTSW 7 4993073 utr 3 prime probably benign
R6680:Zfp579 UTSW 7 4993502 missense probably damaging 0.99
R6826:Zfp579 UTSW 7 4994426 missense probably benign 0.01
R7304:Zfp579 UTSW 7 4994583 missense probably benign 0.22
X0028:Zfp579 UTSW 7 4993933 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGAAGGACCTGTTTCTCCTCC -3'
(R):5'- TACTACCTGTCTCGACACCG -3'

Sequencing Primer
(F):5'- GGACCTGTTTCTCCTCCTGTCG -3'
(R):5'- GTGCCCCAAAGCTTTCCG -3'
Posted On2018-10-18