Incidental Mutation 'R6869:Olfr584'
ID536085
Institutional Source Beutler Lab
Gene Symbol Olfr584
Ensembl Gene ENSMUSG00000073959
Gene Nameolfactory receptor 584
SynonymsGA_x6K02T2PBJ9-5796876-5797820, MOR30-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R6869 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location103081885-103088315 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 103085868 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 112 (V112M)
Ref Sequence ENSEMBL: ENSMUSP00000151043 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098210] [ENSMUST00000214215]
Predicted Effect possibly damaging
Transcript: ENSMUST00000098210
AA Change: V117M

PolyPhen 2 Score 0.469 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000095811
Gene: ENSMUSG00000073959
AA Change: V117M

DomainStartEndE-ValueType
Pfam:7tm_4 38 317 1.4e-110 PFAM
Pfam:7TM_GPCR_Srsx 42 234 2.1e-9 PFAM
Pfam:7tm_1 48 299 4.6e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214215
AA Change: V112M

PolyPhen 2 Score 0.469 (Sensitivity: 0.89; Specificity: 0.90)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 97% (61/63)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankdd1b A T 13: 96,444,291 N166K possibly damaging Het
Arhgap30 G T 1: 171,409,055 R999L probably damaging Het
Bnc2 T A 4: 84,293,496 D212V probably damaging Het
Bpifb5 T C 2: 154,233,223 I357T probably benign Het
Catsperb T C 12: 101,480,737 F208S probably benign Het
Cc2d2b T A 19: 40,809,454 H1105Q probably benign Het
Chchd6 T C 6: 89,595,496 D17G probably damaging Het
Chd6 T C 2: 160,965,730 S1855G probably benign Het
Cpe A G 8: 64,619,427 V143A probably benign Het
Cyfip1 T A 7: 55,907,365 V770D possibly damaging Het
Cyp1a1 A T 9: 57,702,784 M494L probably benign Het
Dcstamp T C 15: 39,754,458 S88P probably damaging Het
Dnah2 T A 11: 69,429,471 N3924I probably damaging Het
F830045P16Rik T C 2: 129,474,561 E76G probably damaging Het
Fam91a1 T A 15: 58,431,268 V342E probably benign Het
Fastkd1 G A 2: 69,702,760 A421V probably benign Het
Fgf20 T C 8: 40,281,148 Y64C probably damaging Het
Gen1 A T 12: 11,241,441 N847K probably benign Het
Gm438 A T 4: 144,780,472 probably null Het
Gm4922 A T 10: 18,784,515 I153K probably damaging Het
Gm6619 T C 6: 131,486,438 I6T unknown Het
H2-Ab1 T C 17: 34,267,563 Y199H probably damaging Het
Hdac7 C A 15: 97,796,176 L737F probably damaging Het
Hells A G 19: 38,940,635 N121D probably benign Het
Itga2 G A 13: 114,875,537 probably null Het
Itgb1 A G 8: 128,720,035 D391G probably benign Het
Lama5 G A 2: 180,191,662 P1519L probably damaging Het
Lbx1 T A 19: 45,234,951 S93C probably damaging Het
Lmod2 T C 6: 24,604,127 M367T probably benign Het
Lrrc43 G A 5: 123,504,276 probably null Het
Man2a2 C T 7: 80,362,945 G574D probably benign Het
Mier2 T G 10: 79,542,669 K343T probably damaging Het
Msh5 A T 17: 35,041,834 probably null Het
Mtus1 T C 8: 41,082,654 Q675R possibly damaging Het
Ncan A T 8: 70,107,907 H803Q probably benign Het
Nckap5l A G 15: 99,426,453 V723A probably damaging Het
Nectin3 G A 16: 46,395,143 R79C probably damaging Het
Nlrc5 A G 8: 94,521,955 E1735G probably benign Het
Nrros A G 16: 32,144,431 L220S probably damaging Het
Olfr1107 T A 2: 87,071,673 I154F probably benign Het
Oxa1l C T 14: 54,366,738 P152S probably damaging Het
Pdcd6ip A G 9: 113,655,106 Y818H unknown Het
Pik3cb A T 9: 99,060,259 S682T probably benign Het
Ppp1r3a A C 6: 14,754,826 S141A probably benign Het
Prrc2c TTGCTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGCTGCTGC 1: 162,709,061 probably benign Het
Ptprk T C 10: 28,473,059 probably null Het
Ranbp17 T C 11: 33,513,074 probably benign Het
Rcbtb1 T C 14: 59,217,602 V95A probably benign Het
Retreg3 G A 11: 101,119,818 probably benign Het
Rhobtb1 T C 10: 69,270,226 L207P probably damaging Het
Rsf1 GGCG GGCGACGGCTGCG 7: 97,579,906 probably benign Het
Sh3bgr A G 16: 96,206,660 Y75C probably damaging Het
Strip1 T C 3: 107,613,445 D763G probably damaging Het
Stxbp5l A T 16: 37,204,448 V596E possibly damaging Het
Tas2r138 A G 6: 40,612,421 I297T probably damaging Het
Topors A C 4: 40,261,201 N694K unknown Het
Tymp T C 15: 89,376,691 R20G probably benign Het
Ubr4 A G 4: 139,467,227 T1144A possibly damaging Het
Unc79 A T 12: 103,113,072 Q1636L probably benign Het
Vmn1r78 A G 7: 12,152,749 M96V probably benign Het
Wfdc8 C T 2: 164,599,092 D244N possibly damaging Het
Zbtb49 G T 5: 38,214,350 N62K probably damaging Het
Zfp579 G T 7: 4,994,461 D150E probably benign Het
Other mutations in Olfr584
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01618:Olfr584 APN 7 103086375 missense probably benign 0.00
IGL02113:Olfr584 APN 7 103085850 missense possibly damaging 0.95
IGL02398:Olfr584 APN 7 103086106 missense probably damaging 1.00
IGL02718:Olfr584 APN 7 103085583 missense probably benign 0.01
IGL02941:Olfr584 APN 7 103086321 missense probably benign 0.05
IGL02942:Olfr584 APN 7 103086198 missense probably benign 0.07
R0496:Olfr584 UTSW 7 103085590 missense probably damaging 1.00
R0511:Olfr584 UTSW 7 103085851 missense probably damaging 1.00
R0646:Olfr584 UTSW 7 103086151 missense probably damaging 0.99
R1652:Olfr584 UTSW 7 103085806 missense probably benign 0.04
R2312:Olfr584 UTSW 7 103086426 missense probably damaging 0.99
R2849:Olfr584 UTSW 7 103086112 missense probably damaging 1.00
R2937:Olfr584 UTSW 7 103086341 missense probably benign 0.01
R3176:Olfr584 UTSW 7 103085750 missense probably damaging 1.00
R3276:Olfr584 UTSW 7 103085750 missense probably damaging 1.00
R3708:Olfr584 UTSW 7 103086294 missense probably damaging 1.00
R4737:Olfr584 UTSW 7 103085914 missense probably damaging 1.00
R5045:Olfr584 UTSW 7 103086457 missense probably benign 0.00
R5172:Olfr584 UTSW 7 103085677 missense probably damaging 1.00
R5849:Olfr584 UTSW 7 103085521 start codon destroyed probably null 0.02
R6294:Olfr584 UTSW 7 103085667 missense probably benign 0.01
R6846:Olfr584 UTSW 7 103086058 missense possibly damaging 0.88
R6936:Olfr584 UTSW 7 103085814 missense probably damaging 0.97
R7133:Olfr584 UTSW 7 103085998 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCAGTGACTGGAAACATCACC -3'
(R):5'- AATGATCTTGTTGGGGCAGAAG -3'

Sequencing Primer
(F):5'- GTGACTGGAAACATCACCATCCTTC -3'
(R):5'- AGGGCATCCTGGAGACCATG -3'
Posted On2018-10-18