Incidental Mutation 'R6869:Pik3cb'
ID536093
Institutional Source Beutler Lab
Gene Symbol Pik3cb
Ensembl Gene ENSMUSG00000032462
Gene Namephosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit beta
Synonymsp110beta, 1110001J02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.957) question?
Stock #R6869 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location99036654-99140621 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 99060259 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 682 (S682T)
Ref Sequence ENSEMBL: ENSMUSP00000035037 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035037] [ENSMUST00000136965]
PDB Structure
CRYSTAL STRUCTURE OF P110BETA IN COMPLEX WITH ICSH2 OF P85BETA AND THE DRUG GDC-0941 [X-RAY DIFFRACTION]
Discovery and Optimization of Pyrimidone Indoline Amide PI3Kbeta Inhibitors for the Treatment of Phosphatase and TENsin homologue (PTEN)-Deficient Cancers [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000035037
AA Change: S682T

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000035037
Gene: ENSMUSG00000032462
AA Change: S682T

DomainStartEndE-ValueType
PI3K_p85B 35 112 2.44e-50 SMART
PI3K_rbd 174 282 1.88e-42 SMART
low complexity region 305 311 N/A INTRINSIC
PI3K_C2 315 417 4.64e-33 SMART
PI3Ka 519 705 1.08e-92 SMART
PI3Kc 795 1061 8.75e-134 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136965
SMART Domains Protein: ENSMUSP00000138346
Gene: ENSMUSG00000032462

DomainStartEndE-ValueType
PI3K_p85B 35 112 2.44e-50 SMART
PI3K_rbd 174 282 1.88e-42 SMART
low complexity region 305 311 N/A INTRINSIC
PI3K_C2 315 417 4.64e-33 SMART
Blast:PI3Ka 450 520 1e-37 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 97% (61/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an isoform of the catalytic subunit of phosphoinositide 3-kinase (PI3K). These kinases are important in signaling pathways involving receptors on the outer membrane of eukaryotic cells and are named for their catalytic subunit. The encoded protein is the catalytic subunit for PI3Kbeta (PI3KB). PI3KB has been shown to be part of the activation pathway in neutrophils which have bound immune complexes at sites of injury or infection. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit 30% fetal lethality, decreased size at birth and postnatally, abnormal glucose homeostasis, and dyslipidemia. Mice homozygous for a different knock-out allele die prior to E8.5 [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankdd1b A T 13: 96,444,291 N166K possibly damaging Het
Arhgap30 G T 1: 171,409,055 R999L probably damaging Het
Bnc2 T A 4: 84,293,496 D212V probably damaging Het
Bpifb5 T C 2: 154,233,223 I357T probably benign Het
Catsperb T C 12: 101,480,737 F208S probably benign Het
Cc2d2b T A 19: 40,809,454 H1105Q probably benign Het
Chchd6 T C 6: 89,595,496 D17G probably damaging Het
Chd6 T C 2: 160,965,730 S1855G probably benign Het
Cpe A G 8: 64,619,427 V143A probably benign Het
Cyfip1 T A 7: 55,907,365 V770D possibly damaging Het
Cyp1a1 A T 9: 57,702,784 M494L probably benign Het
Dcstamp T C 15: 39,754,458 S88P probably damaging Het
Dnah2 T A 11: 69,429,471 N3924I probably damaging Het
F830045P16Rik T C 2: 129,474,561 E76G probably damaging Het
Fam91a1 T A 15: 58,431,268 V342E probably benign Het
Fastkd1 G A 2: 69,702,760 A421V probably benign Het
Fgf20 T C 8: 40,281,148 Y64C probably damaging Het
Gen1 A T 12: 11,241,441 N847K probably benign Het
Gm438 A T 4: 144,780,472 probably null Het
Gm4922 A T 10: 18,784,515 I153K probably damaging Het
Gm6619 T C 6: 131,486,438 I6T unknown Het
H2-Ab1 T C 17: 34,267,563 Y199H probably damaging Het
Hdac7 C A 15: 97,796,176 L737F probably damaging Het
Hells A G 19: 38,940,635 N121D probably benign Het
Itga2 G A 13: 114,875,537 probably null Het
Itgb1 A G 8: 128,720,035 D391G probably benign Het
Lama5 G A 2: 180,191,662 P1519L probably damaging Het
Lbx1 T A 19: 45,234,951 S93C probably damaging Het
Lmod2 T C 6: 24,604,127 M367T probably benign Het
Lrrc43 G A 5: 123,504,276 probably null Het
Man2a2 C T 7: 80,362,945 G574D probably benign Het
Mier2 T G 10: 79,542,669 K343T probably damaging Het
Msh5 A T 17: 35,041,834 probably null Het
Mtus1 T C 8: 41,082,654 Q675R possibly damaging Het
Ncan A T 8: 70,107,907 H803Q probably benign Het
Nckap5l A G 15: 99,426,453 V723A probably damaging Het
Nectin3 G A 16: 46,395,143 R79C probably damaging Het
Nlrc5 A G 8: 94,521,955 E1735G probably benign Het
Nrros A G 16: 32,144,431 L220S probably damaging Het
Olfr1107 T A 2: 87,071,673 I154F probably benign Het
Olfr584 G A 7: 103,085,868 V112M possibly damaging Het
Oxa1l C T 14: 54,366,738 P152S probably damaging Het
Pdcd6ip A G 9: 113,655,106 Y818H unknown Het
Ppp1r3a A C 6: 14,754,826 S141A probably benign Het
Prrc2c TTGCTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGCTGCTGC 1: 162,709,061 probably benign Het
Ptprk T C 10: 28,473,059 probably null Het
Ranbp17 T C 11: 33,513,074 probably benign Het
Rcbtb1 T C 14: 59,217,602 V95A probably benign Het
Retreg3 G A 11: 101,119,818 probably benign Het
Rhobtb1 T C 10: 69,270,226 L207P probably damaging Het
Rsf1 GGCG GGCGACGGCTGCG 7: 97,579,906 probably benign Het
Sh3bgr A G 16: 96,206,660 Y75C probably damaging Het
Strip1 T C 3: 107,613,445 D763G probably damaging Het
Stxbp5l A T 16: 37,204,448 V596E possibly damaging Het
Tas2r138 A G 6: 40,612,421 I297T probably damaging Het
Topors A C 4: 40,261,201 N694K unknown Het
Tymp T C 15: 89,376,691 R20G probably benign Het
Ubr4 A G 4: 139,467,227 T1144A possibly damaging Het
Unc79 A T 12: 103,113,072 Q1636L probably benign Het
Vmn1r78 A G 7: 12,152,749 M96V probably benign Het
Wfdc8 C T 2: 164,599,092 D244N possibly damaging Het
Zbtb49 G T 5: 38,214,350 N62K probably damaging Het
Zfp579 G T 7: 4,994,461 D150E probably benign Het
Other mutations in Pik3cb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00933:Pik3cb APN 9 99101286 missense probably damaging 0.96
IGL01354:Pik3cb APN 9 99064168 missense possibly damaging 0.83
IGL02132:Pik3cb APN 9 99071377 missense probably benign 0.01
IGL02268:Pik3cb APN 9 99046556 missense probably benign 0.00
IGL02376:Pik3cb APN 9 99052352 missense probably benign 0.00
IGL02378:Pik3cb APN 9 99062840 missense probably benign 0.40
IGL02748:Pik3cb APN 9 99062968 splice site probably benign
IGL03038:Pik3cb APN 9 99065597 missense probably damaging 1.00
IGL03142:Pik3cb APN 9 99065562 missense probably benign 0.10
H8786:Pik3cb UTSW 9 99046559 missense possibly damaging 0.80
R0071:Pik3cb UTSW 9 99044865 missense probably benign 0.02
R0071:Pik3cb UTSW 9 99044865 missense probably benign 0.02
R0305:Pik3cb UTSW 9 99064076 missense possibly damaging 0.86
R0464:Pik3cb UTSW 9 99044743 critical splice donor site probably null
R0635:Pik3cb UTSW 9 99064218 splice site probably benign
R1386:Pik3cb UTSW 9 99064027 missense possibly damaging 0.90
R1530:Pik3cb UTSW 9 99053973 missense probably damaging 0.96
R1802:Pik3cb UTSW 9 99101289 nonsense probably null
R1815:Pik3cb UTSW 9 99093095 missense possibly damaging 0.93
R2011:Pik3cb UTSW 9 99105579 nonsense probably null
R2079:Pik3cb UTSW 9 99060204 missense probably benign 0.27
R2153:Pik3cb UTSW 9 99101244 nonsense probably null
R2237:Pik3cb UTSW 9 99041028 missense probably damaging 1.00
R2238:Pik3cb UTSW 9 99041028 missense probably damaging 1.00
R2513:Pik3cb UTSW 9 99061842 missense probably damaging 1.00
R3982:Pik3cb UTSW 9 99046601 missense probably benign 0.06
R4009:Pik3cb UTSW 9 99040929 missense probably damaging 0.98
R4246:Pik3cb UTSW 9 99101176 splice site probably null
R4248:Pik3cb UTSW 9 99101176 splice site probably null
R4249:Pik3cb UTSW 9 99101176 splice site probably null
R4334:Pik3cb UTSW 9 99061851 missense probably damaging 1.00
R4544:Pik3cb UTSW 9 99039759 missense probably damaging 1.00
R4568:Pik3cb UTSW 9 99090302 missense probably benign 0.00
R4571:Pik3cb UTSW 9 99090257 missense possibly damaging 0.94
R4595:Pik3cb UTSW 9 99055406 missense possibly damaging 0.95
R4599:Pik3cb UTSW 9 99061764 missense probably benign 0.15
R4820:Pik3cb UTSW 9 99073626 missense probably benign 0.00
R4887:Pik3cb UTSW 9 99101328 missense probably damaging 0.99
R4967:Pik3cb UTSW 9 99105632 missense probably benign 0.14
R5029:Pik3cb UTSW 9 99054060 missense probably damaging 0.98
R5031:Pik3cb UTSW 9 99071408 missense probably damaging 1.00
R5394:Pik3cb UTSW 9 99088663 missense probably benign
R5769:Pik3cb UTSW 9 99093159 nonsense probably null
R6128:Pik3cb UTSW 9 99064099 missense possibly damaging 0.95
R6250:Pik3cb UTSW 9 99094598 missense probably benign 0.01
R6354:Pik3cb UTSW 9 99073643 missense probably benign 0.00
R6370:Pik3cb UTSW 9 99040934 missense probably damaging 1.00
R6664:Pik3cb UTSW 9 99094538 missense possibly damaging 0.56
R6665:Pik3cb UTSW 9 99073649 missense probably benign 0.00
R6751:Pik3cb UTSW 9 99094521 missense probably benign
R6781:Pik3cb UTSW 9 99040992 missense possibly damaging 0.52
R6883:Pik3cb UTSW 9 99101400 missense probably benign 0.00
R7150:Pik3cb UTSW 9 99093090 missense probably damaging 1.00
R7446:Pik3cb UTSW 9 99046658 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCACTGATCAGGGTAAGTGAC -3'
(R):5'- CACTAAGATCTCATAACTTCTGAGTCC -3'

Sequencing Primer
(F):5'- AAGTCCCTACCTGTTTGG -3'
(R):5'- CTGAGTCCTAACTGCGGTATGAC -3'
Posted On2018-10-18