Incidental Mutation 'R6869:Tymp'
ID536111
Institutional Source Beutler Lab
Gene Symbol Tymp
Ensembl Gene ENSMUSG00000022615
Gene Namethymidine phosphorylase
Synonyms2900072D10Rik, PD-ECGF, gliostatin, Pdgfec, PDECGF, Ecgf1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6869 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location89371931-89377039 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89376691 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 20 (R20G)
Ref Sequence ENSEMBL: ENSMUSP00000023285 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023285] [ENSMUST00000036987] [ENSMUST00000049968] [ENSMUST00000074552] [ENSMUST00000088717] [ENSMUST00000145259] [ENSMUST00000167643] [ENSMUST00000227834] [ENSMUST00000228111] [ENSMUST00000228977]
Predicted Effect probably benign
Transcript: ENSMUST00000023285
AA Change: R20G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000023285
Gene: ENSMUSG00000022615
AA Change: R20G

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
Pfam:Glycos_trans_3N 23 85 1.5e-20 PFAM
Pfam:Glycos_transf_3 95 326 3.1e-50 PFAM
PYNP_C 374 448 6.46e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000036987
SMART Domains Protein: ENSMUSP00000036900
Gene: ENSMUSG00000008690

DomainStartEndE-ValueType
Pfam:DUF1032 20 576 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000049968
SMART Domains Protein: ENSMUSP00000053112
Gene: ENSMUSG00000047394

DomainStartEndE-ValueType
Pfam:SHIPPO-rpt 24 60 1.4e-4 PFAM
Pfam:SHIPPO-rpt 101 129 1.6e-3 PFAM
Pfam:SHIPPO-rpt 138 172 2.7e-6 PFAM
Pfam:SHIPPO-rpt 181 211 2.5e-5 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000074552
SMART Domains Protein: ENSMUSP00000074139
Gene: ENSMUSG00000008690

DomainStartEndE-ValueType
Pfam:DUF1032 51 607 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000088717
SMART Domains Protein: ENSMUSP00000086095
Gene: ENSMUSG00000008690

DomainStartEndE-ValueType
Pfam:CNDH2_N 11 123 1.2e-48 PFAM
Pfam:CNDH2_M 147 285 2.1e-20 PFAM
Pfam:CNDH2_C 308 598 1.9e-90 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145259
Predicted Effect probably benign
Transcript: ENSMUST00000167643
SMART Domains Protein: ENSMUSP00000131943
Gene: ENSMUSG00000091780

DomainStartEndE-ValueType
Pfam:SCO1-SenC 52 234 1.4e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000227834
Predicted Effect probably benign
Transcript: ENSMUST00000228111
Predicted Effect probably benign
Transcript: ENSMUST00000228977
Meta Mutation Damage Score 0.0996 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 97% (61/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an angiogenic factor which promotes angiogenesis in vivo and stimulates the in vitro growth of a variety of endothelial cells. It has a highly restricted target cell specificity acting only on endothelial cells. Mutations in this gene have been associated with mitochondrial neurogastrointestinal encephalomyopathy. Multiple alternatively spliced transcript variants have been identified. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit reduced thymidine phosphorylase activity and increased thymidine levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankdd1b A T 13: 96,444,291 N166K possibly damaging Het
Arhgap30 G T 1: 171,409,055 R999L probably damaging Het
Bnc2 T A 4: 84,293,496 D212V probably damaging Het
Bpifb5 T C 2: 154,233,223 I357T probably benign Het
Catsperb T C 12: 101,480,737 F208S probably benign Het
Cc2d2b T A 19: 40,809,454 H1105Q probably benign Het
Chchd6 T C 6: 89,595,496 D17G probably damaging Het
Chd6 T C 2: 160,965,730 S1855G probably benign Het
Cpe A G 8: 64,619,427 V143A probably benign Het
Cyfip1 T A 7: 55,907,365 V770D possibly damaging Het
Cyp1a1 A T 9: 57,702,784 M494L probably benign Het
Dcstamp T C 15: 39,754,458 S88P probably damaging Het
Dnah2 T A 11: 69,429,471 N3924I probably damaging Het
F830045P16Rik T C 2: 129,474,561 E76G probably damaging Het
Fam91a1 T A 15: 58,431,268 V342E probably benign Het
Fastkd1 G A 2: 69,702,760 A421V probably benign Het
Fgf20 T C 8: 40,281,148 Y64C probably damaging Het
Gen1 A T 12: 11,241,441 N847K probably benign Het
Gm438 A T 4: 144,780,472 probably null Het
Gm4922 A T 10: 18,784,515 I153K probably damaging Het
Gm6619 T C 6: 131,486,438 I6T unknown Het
H2-Ab1 T C 17: 34,267,563 Y199H probably damaging Het
Hdac7 C A 15: 97,796,176 L737F probably damaging Het
Hells A G 19: 38,940,635 N121D probably benign Het
Itga2 G A 13: 114,875,537 probably null Het
Itgb1 A G 8: 128,720,035 D391G probably benign Het
Lama5 G A 2: 180,191,662 P1519L probably damaging Het
Lbx1 T A 19: 45,234,951 S93C probably damaging Het
Lmod2 T C 6: 24,604,127 M367T probably benign Het
Lrrc43 G A 5: 123,504,276 probably null Het
Man2a2 C T 7: 80,362,945 G574D probably benign Het
Mier2 T G 10: 79,542,669 K343T probably damaging Het
Msh5 A T 17: 35,041,834 probably null Het
Mtus1 T C 8: 41,082,654 Q675R possibly damaging Het
Ncan A T 8: 70,107,907 H803Q probably benign Het
Nckap5l A G 15: 99,426,453 V723A probably damaging Het
Nectin3 G A 16: 46,395,143 R79C probably damaging Het
Nlrc5 A G 8: 94,521,955 E1735G probably benign Het
Nrros A G 16: 32,144,431 L220S probably damaging Het
Olfr1107 T A 2: 87,071,673 I154F probably benign Het
Olfr584 G A 7: 103,085,868 V112M possibly damaging Het
Oxa1l C T 14: 54,366,738 P152S probably damaging Het
Pdcd6ip A G 9: 113,655,106 Y818H unknown Het
Pik3cb A T 9: 99,060,259 S682T probably benign Het
Ppp1r3a A C 6: 14,754,826 S141A probably benign Het
Prrc2c TTGCTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGCTGCTGC 1: 162,709,061 probably benign Het
Ptprk T C 10: 28,473,059 probably null Het
Ranbp17 T C 11: 33,513,074 probably benign Het
Rcbtb1 T C 14: 59,217,602 V95A probably benign Het
Retreg3 G A 11: 101,119,818 probably benign Het
Rhobtb1 T C 10: 69,270,226 L207P probably damaging Het
Rsf1 GGCG GGCGACGGCTGCG 7: 97,579,906 probably benign Het
Sh3bgr A G 16: 96,206,660 Y75C probably damaging Het
Strip1 T C 3: 107,613,445 D763G probably damaging Het
Stxbp5l A T 16: 37,204,448 V596E possibly damaging Het
Tas2r138 A G 6: 40,612,421 I297T probably damaging Het
Topors A C 4: 40,261,201 N694K unknown Het
Ubr4 A G 4: 139,467,227 T1144A possibly damaging Het
Unc79 A T 12: 103,113,072 Q1636L probably benign Het
Vmn1r78 A G 7: 12,152,749 M96V probably benign Het
Wfdc8 C T 2: 164,599,092 D244N possibly damaging Het
Zbtb49 G T 5: 38,214,350 N62K probably damaging Het
Zfp579 G T 7: 4,994,461 D150E probably benign Het
Other mutations in Tymp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01013:Tymp APN 15 89376310 missense probably damaging 1.00
IGL03355:Tymp APN 15 89375016 missense possibly damaging 0.80
PIT4142001:Tymp UTSW 15 89376345 missense probably damaging 1.00
R0791:Tymp UTSW 15 89374818 missense probably damaging 1.00
R2219:Tymp UTSW 15 89374762 missense probably benign
R2266:Tymp UTSW 15 89373808 missense probably damaging 1.00
R2267:Tymp UTSW 15 89373808 missense probably damaging 1.00
R2268:Tymp UTSW 15 89373808 missense probably damaging 1.00
R4714:Tymp UTSW 15 89376307 missense probably damaging 1.00
R5247:Tymp UTSW 15 89374364 frame shift probably null
R5248:Tymp UTSW 15 89374364 frame shift probably null
R5249:Tymp UTSW 15 89374364 frame shift probably null
R5741:Tymp UTSW 15 89376436 missense probably benign 0.18
R5810:Tymp UTSW 15 89374331 missense probably damaging 0.99
R5960:Tymp UTSW 15 89376575 critical splice donor site probably null
R6082:Tymp UTSW 15 89374364 frame shift probably null
R6083:Tymp UTSW 15 89374364 frame shift probably null
R6085:Tymp UTSW 15 89374364 frame shift probably null
R6566:Tymp UTSW 15 89373600 missense probably benign
R6969:Tymp UTSW 15 89374048 missense probably benign 0.04
R7019:Tymp UTSW 15 89376281 synonymous probably null
Predicted Primers PCR Primer
(F):5'- AATGAGCGAGGTGTTCACG -3'
(R):5'- TGCCAGAGACCCTGTAAGAG -3'

Sequencing Primer
(F):5'- AGGTGTTCACGCAGTCTGAG -3'
(R):5'- CCCTGTAAGAGCAAGGTTTGGAC -3'
Posted On2018-10-18