Incidental Mutation 'R6869:Cc2d2b'
ID536120
Institutional Source Beutler Lab
Gene Symbol Cc2d2b
Ensembl Gene ENSMUSG00000108929
Gene Namecoiled-coil and C2 domain containing 2B
SynonymsEG668310
MMRRC Submission
Accession Numbers

NCBI RefSeq: XM_001000795; MGI: 3645359

Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R6869 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location40748753-40827743 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 40809454 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 1105 (H1105Q)
Ref Sequence ENSEMBL: ENSMUSP00000153384 (fasta)
Predicted Effect unknown
Transcript: ENSMUST00000207801
AA Change: H839Q
Predicted Effect probably benign
Transcript: ENSMUST00000224596
AA Change: H1105Q

PolyPhen 2 Score 0.065 (Sensitivity: 0.94; Specificity: 0.84)
Meta Mutation Damage Score 0.0532 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 97% (61/63)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankdd1b A T 13: 96,444,291 N166K possibly damaging Het
Arhgap30 G T 1: 171,409,055 R999L probably damaging Het
Bnc2 T A 4: 84,293,496 D212V probably damaging Het
Bpifb5 T C 2: 154,233,223 I357T probably benign Het
Catsperb T C 12: 101,480,737 F208S probably benign Het
Chchd6 T C 6: 89,595,496 D17G probably damaging Het
Chd6 T C 2: 160,965,730 S1855G probably benign Het
Cpe A G 8: 64,619,427 V143A probably benign Het
Cyfip1 T A 7: 55,907,365 V770D possibly damaging Het
Cyp1a1 A T 9: 57,702,784 M494L probably benign Het
Dcstamp T C 15: 39,754,458 S88P probably damaging Het
Dnah2 T A 11: 69,429,471 N3924I probably damaging Het
F830045P16Rik T C 2: 129,474,561 E76G probably damaging Het
Fam91a1 T A 15: 58,431,268 V342E probably benign Het
Fastkd1 G A 2: 69,702,760 A421V probably benign Het
Fgf20 T C 8: 40,281,148 Y64C probably damaging Het
Gen1 A T 12: 11,241,441 N847K probably benign Het
Gm438 A T 4: 144,780,472 probably null Het
Gm4922 A T 10: 18,784,515 I153K probably damaging Het
Gm6619 T C 6: 131,486,438 I6T unknown Het
H2-Ab1 T C 17: 34,267,563 Y199H probably damaging Het
Hdac7 C A 15: 97,796,176 L737F probably damaging Het
Hells A G 19: 38,940,635 N121D probably benign Het
Itga2 G A 13: 114,875,537 probably null Het
Itgb1 A G 8: 128,720,035 D391G probably benign Het
Lama5 G A 2: 180,191,662 P1519L probably damaging Het
Lbx1 T A 19: 45,234,951 S93C probably damaging Het
Lmod2 T C 6: 24,604,127 M367T probably benign Het
Lrrc43 G A 5: 123,504,276 probably null Het
Man2a2 C T 7: 80,362,945 G574D probably benign Het
Mier2 T G 10: 79,542,669 K343T probably damaging Het
Msh5 A T 17: 35,041,834 probably null Het
Mtus1 T C 8: 41,082,654 Q675R possibly damaging Het
Ncan A T 8: 70,107,907 H803Q probably benign Het
Nckap5l A G 15: 99,426,453 V723A probably damaging Het
Nectin3 G A 16: 46,395,143 R79C probably damaging Het
Nlrc5 A G 8: 94,521,955 E1735G probably benign Het
Nrros A G 16: 32,144,431 L220S probably damaging Het
Olfr1107 T A 2: 87,071,673 I154F probably benign Het
Olfr584 G A 7: 103,085,868 V112M possibly damaging Het
Oxa1l C T 14: 54,366,738 P152S probably damaging Het
Pdcd6ip A G 9: 113,655,106 Y818H unknown Het
Pik3cb A T 9: 99,060,259 S682T probably benign Het
Ppp1r3a A C 6: 14,754,826 S141A probably benign Het
Prrc2c TTGCTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGCTGCTGC 1: 162,709,061 probably benign Het
Ptprk T C 10: 28,473,059 probably null Het
Ranbp17 T C 11: 33,513,074 probably benign Het
Rcbtb1 T C 14: 59,217,602 V95A probably benign Het
Retreg3 G A 11: 101,119,818 probably benign Het
Rhobtb1 T C 10: 69,270,226 L207P probably damaging Het
Rsf1 GGCG GGCGACGGCTGCG 7: 97,579,906 probably benign Het
Sh3bgr A G 16: 96,206,660 Y75C probably damaging Het
Strip1 T C 3: 107,613,445 D763G probably damaging Het
Stxbp5l A T 16: 37,204,448 V596E possibly damaging Het
Tas2r138 A G 6: 40,612,421 I297T probably damaging Het
Topors A C 4: 40,261,201 N694K unknown Het
Tymp T C 15: 89,376,691 R20G probably benign Het
Ubr4 A G 4: 139,467,227 T1144A possibly damaging Het
Unc79 A T 12: 103,113,072 Q1636L probably benign Het
Vmn1r78 A G 7: 12,152,749 M96V probably benign Het
Wfdc8 C T 2: 164,599,092 D244N possibly damaging Het
Zbtb49 G T 5: 38,214,350 N62K probably damaging Het
Zfp579 G T 7: 4,994,461 D150E probably benign Het
Other mutations in Cc2d2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
1mM(1):Cc2d2b UTSW 19 40795685 missense possibly damaging 0.60
R6163:Cc2d2b UTSW 19 40756506 missense probably benign 0.31
R6481:Cc2d2b UTSW 19 40802395 missense possibly damaging 0.95
R6651:Cc2d2b UTSW 19 40778129 missense probably damaging 0.97
R6747:Cc2d2b UTSW 19 40795667 missense probably benign 0.03
R6799:Cc2d2b UTSW 19 40791208 missense possibly damaging 0.69
R6857:Cc2d2b UTSW 19 40770865 missense possibly damaging 0.62
R6881:Cc2d2b UTSW 19 40825039 missense probably damaging 0.99
R6900:Cc2d2b UTSW 19 40825074 missense probably null 0.08
R6902:Cc2d2b UTSW 19 40816289 missense possibly damaging 0.93
R6960:Cc2d2b UTSW 19 40785062 missense possibly damaging 0.85
R7016:Cc2d2b UTSW 19 40795804 missense possibly damaging 0.85
R7039:Cc2d2b UTSW 19 40802401 missense probably damaging 1.00
R7072:Cc2d2b UTSW 19 40760359 missense unknown
R7192:Cc2d2b UTSW 19 40774437 missense unknown
R7226:Cc2d2b UTSW 19 40791307 missense unknown
R7303:Cc2d2b UTSW 19 40808994 missense unknown
R7324:Cc2d2b UTSW 19 40809108 missense unknown
Predicted Primers PCR Primer
(F):5'- AGGCATAGTGTTGAGCTGCC -3'
(R):5'- CCCAGATAAAAGGTGCAGTTG -3'

Sequencing Primer
(F):5'- GCATAGTGTTGAGCTGCCTTAAATC -3'
(R):5'- CTTTAGTCCTAGAACTCAGGAGG -3'
Posted On2018-10-18