Incidental Mutation 'R6871:2610044O15Rik8'
List |< first << previous [record 54 of 10171] next >> last >|
ID536175
Institutional Source Beutler Lab
Gene Symbol 2610044O15Rik8
Ensembl Gene ENSMUSG00000071302
Gene NameRIKEN cDNA 2610044O15 gene
Synonyms
Accession Numbers
Is this an essential gene? Not available question?
Stock #R6871 (G1) of strain 613
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location129216354-129234406 bp(-) (GRCm38)
Type of Mutationutr 5 prime
DNA Base Change (assembly) A to C at 129234400 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000186619] [ENSMUST00000188757] [ENSMUST00000189965] [ENSMUST00000190157] [ENSMUST00000191043]
Predicted Effect probably benign
Transcript: ENSMUST00000186619
SMART Domains Protein: ENSMUSP00000140654
Gene: ENSMUSG00000071302

DomainStartEndE-ValueType
KRAB 4 66 1.2e-15 SMART
ZnF_C2H2 75 97 3.7e-2 SMART
ZnF_C2H2 103 125 3e-4 SMART
ZnF_C2H2 131 153 3.7e-5 SMART
ZnF_C2H2 159 181 4e-6 SMART
ZnF_C2H2 187 209 9.6e-6 SMART
ZnF_C2H2 215 237 8.7e-6 SMART
ZnF_C2H2 243 265 1.2e-5 SMART
ZnF_C2H2 271 293 9.9e-6 SMART
ZnF_C2H2 299 321 8.3e-6 SMART
ZnF_C2H2 327 349 3.8e-7 SMART
ZnF_C2H2 355 377 2.5e-5 SMART
ZnF_C2H2 383 405 3.9e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188757
SMART Domains Protein: ENSMUSP00000140555
Gene: ENSMUSG00000071302

DomainStartEndE-ValueType
KRAB 4 66 2.79e-13 SMART
Predicted Effect probably null
Transcript: ENSMUST00000189965
SMART Domains Protein: ENSMUSP00000140304
Gene: ENSMUSG00000071302

DomainStartEndE-ValueType
KRAB 4 66 1.2e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190157
SMART Domains Protein: ENSMUSP00000140736
Gene: ENSMUSG00000071302

DomainStartEndE-ValueType
KRAB 4 66 2.79e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191043
SMART Domains Protein: ENSMUSP00000139392
Gene: ENSMUSG00000071302

DomainStartEndE-ValueType
KRAB 4 66 6.1e-16 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 7 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arsi G A 18: 60,916,651 G202E probably benign Het
Cntn6 GAATCA GAATCAATCA 6: 104,845,758 probably null Het
Dnah5 C A 15: 28,229,640 T140K probably benign Het
Itih3 T C 14: 30,912,687 N121S probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrch1 A G 14: 74,811,623 S395P probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Other mutations in 2610044O15Rik8
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1956:2610044O15Rik8 UTSW 8 129221828 missense possibly damaging 0.82
R6740:2610044O15Rik8 UTSW 8 129234400 utr 5 prime probably null
Predicted Primers PCR Primer
(F):5'- TGATATCTCTCGTCCCATGCAG -3'
(R):5'- AGCTGAAATGCTGTGTCCTC -3'

Sequencing Primer
(F):5'- CATGCAGCCCTGGAAGAG -3'
(R):5'- CACGGCTTGGAGGATAGGC -3'
Posted On2018-10-18