Mutagenetix > Incidental Mutation

Incidental Mutation 'R6871:Itih3'

536177

Institutional Source

Beutler Lab

Gene Symbol

Itih3

Ensembl Gene

ENSMUSG00000006522

Gene Name

inter-alpha trypsin inhibitor, heavy chain 3

Synonyms

Itih-3, Intin3

MMRRC Submission

044968-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.058) question?

Stock #

R6871 (G1) of strain 613

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

30630529-30645717 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 30634644 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 121 (N121S)

Ref Sequence

ENSEMBL: ENSMUSP00000154256 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006697] [ENSMUST00000226547] [ENSMUST00000228114] [ENSMUST00000227995]

AlphaFold

Q61704

Predicted Effect

probably benign
Transcript: ENSMUST00000006697
AA Change: N660S

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000006697
Gene: ENSMUSG00000006522
AA Change: N660S

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
VIT	29	158	3.87e-83	SMART
VWA	282	466	1.19e-29	SMART
Blast:VWA	571	634	2e-21	BLAST
Pfam:ITI_HC_C	683	870	3e-73	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000112141

Predicted Effect

probably benign
Transcript: ENSMUST00000166622
AA Change: N121S

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000131805
Gene: ENSMUSG00000006522
AA Change: N121S

Domain	Start	End	E-Value	Type
Blast:VWA	17	80	1e-23	BLAST
Pfam:ITI_HC_C	143	224	3.9e-26	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000169620

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226179

Predicted Effect

probably benign
Transcript: ENSMUST00000226547
AA Change: N121S

PolyPhen 2 Score 0.401 (Sensitivity: 0.89; Specificity: 0.89)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227181

Predicted Effect

probably benign
Transcript: ENSMUST00000228114

Predicted Effect

probably benign
Transcript: ENSMUST00000227995

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.1%

Validation Efficiency

100% (16/16)

MGI Phenotype

FUNCTION: This gene encodes one of the heavy subunits of inter alpha trypsin inhibitor that functions as a protease inhibitor circulating in the plasma. The encoded protein undergoes proteolytic processing to generate a mature glycoprotein that is linked to the other subunits via an ester bond between the C-terminal aspartic acid residue and the N-acetyl galactosamine residue of chondroitin sulfate. This gene is located in a cluster of related inter alpha trypsin inhibitor genes on chromosome 14. [provided by RefSeq, Oct 2015]

Allele List at MGI

Other mutations in this stock

Total: 9 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arsi	G	A	18: 61,049,723 (GRCm39)	G202E	probably benign	Het
Cntn6	GAATCA	GAATCAATCA	6: 104,822,719 (GRCm39)		probably null	Het
Dnah5	C	A	15: 28,229,786 (GRCm39)	T140K	probably benign	Het
Lgr6	C	T	1: 134,921,748 (GRCm39)	A199T	probably damaging	Het
Lrch1	A	G	14: 75,049,063 (GRCm39)	S395P	probably benign	Het
Pax5	T	A	4: 44,710,583 (GRCm39)		probably benign	Het
Piezo1	G	A	8: 123,211,766 (GRCm39)		probably null	Het
Top2b	T	G	14: 16,409,189 (GRCm38)	I777M	probably damaging	Het
Zfp1006	A	C	8: 129,960,881 (GRCm39)		probably null	Het

Other mutations in Itih3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01092:Itih3	APN	14	30,631,738 (GRCm39)	missense	probably damaging	0.98
IGL01359:Itih3	APN	14	30,639,729 (GRCm39)	missense	probably damaging	1.00
IGL01965:Itih3	APN	14	30,637,677 (GRCm39)	missense	probably damaging	0.99
IGL02435:Itih3	APN	14	30,637,711 (GRCm39)	missense	probably damaging	0.99
IGL02539:Itih3	APN	14	30,634,621 (GRCm39)	missense	probably benign	0.03
IGL02637:Itih3	APN	14	30,637,617 (GRCm39)	missense	probably benign	0.00
IGL02958:Itih3	APN	14	30,635,139 (GRCm39)	missense	probably benign	0.00
IGL03253:Itih3	APN	14	30,633,880 (GRCm39)	critical splice donor site	probably null
K2124:Itih3	UTSW	14	30,634,644 (GRCm39)	missense	probably benign	0.40
R0321:Itih3	UTSW	14	30,634,063 (GRCm39)	missense	probably damaging	0.99
R0466:Itih3	UTSW	14	30,634,831 (GRCm39)	critical splice donor site	probably null
R1402:Itih3	UTSW	14	30,630,665 (GRCm39)	missense	probably damaging	1.00
R1402:Itih3	UTSW	14	30,630,665 (GRCm39)	missense	probably damaging	1.00
R1633:Itih3	UTSW	14	30,639,355 (GRCm39)	missense	possibly damaging	0.46
R1982:Itih3	UTSW	14	30,645,540 (GRCm39)	unclassified	probably benign
R2056:Itih3	UTSW	14	30,631,481 (GRCm39)	splice site	probably null
R2077:Itih3	UTSW	14	30,631,792 (GRCm39)	missense	possibly damaging	0.91
R2417:Itih3	UTSW	14	30,639,621 (GRCm39)	missense	probably benign	0.04
R3624:Itih3	UTSW	14	30,636,700 (GRCm39)	missense	probably damaging	1.00
R3794:Itih3	UTSW	14	30,640,351 (GRCm39)	missense	probably damaging	1.00
R4676:Itih3	UTSW	14	30,643,643 (GRCm39)	missense	possibly damaging	0.91
R4676:Itih3	UTSW	14	30,640,906 (GRCm39)	missense	probably null	1.00
R5198:Itih3	UTSW	14	30,634,606 (GRCm39)	missense	probably benign	0.07
R5429:Itih3	UTSW	14	30,645,478 (GRCm39)	missense	probably benign	0.00
R6379:Itih3	UTSW	14	30,631,681 (GRCm39)	missense	probably damaging	1.00
R6740:Itih3	UTSW	14	30,634,644 (GRCm39)	missense	probably benign	0.40
R6752:Itih3	UTSW	14	30,645,446 (GRCm39)	missense	possibly damaging	0.76
R6765:Itih3	UTSW	14	30,631,430 (GRCm39)	missense	probably benign
R6785:Itih3	UTSW	14	30,634,572 (GRCm39)	critical splice donor site	probably null
R6935:Itih3	UTSW	14	30,634,659 (GRCm39)	missense	possibly damaging	0.82
R7133:Itih3	UTSW	14	30,639,655 (GRCm39)	missense	probably damaging	1.00
R7419:Itih3	UTSW	14	30,636,730 (GRCm39)	missense	probably benign	0.41
R7592:Itih3	UTSW	14	30,630,722 (GRCm39)	missense	probably damaging	0.98
R7598:Itih3	UTSW	14	30,639,334 (GRCm39)	missense	possibly damaging	0.95
R7662:Itih3	UTSW	14	30,639,287 (GRCm39)	missense	probably benign	0.00
R8183:Itih3	UTSW	14	30,631,433 (GRCm39)	missense	probably benign
R8682:Itih3	UTSW	14	30,642,673 (GRCm39)	missense	possibly damaging	0.81
R8723:Itih3	UTSW	14	30,630,761 (GRCm39)	missense	probably damaging	1.00
R8794:Itih3	UTSW	14	30,634,854 (GRCm39)	missense	possibly damaging	0.71
R8892:Itih3	UTSW	14	30,637,635 (GRCm39)	missense	probably benign
R9358:Itih3	UTSW	14	30,643,885 (GRCm39)	nonsense	probably null
R9399:Itih3	UTSW	14	30,643,335 (GRCm39)	missense	probably benign	0.37
R9476:Itih3	UTSW	14	30,631,416 (GRCm39)	missense	probably benign	0.14
R9510:Itih3	UTSW	14	30,631,416 (GRCm39)	missense	probably benign	0.14
R9649:Itih3	UTSW	14	30,637,605 (GRCm39)	missense	possibly damaging	0.92
R9690:Itih3	UTSW	14	30,640,264 (GRCm39)	missense	probably benign
R9709:Itih3	UTSW	14	30,637,587 (GRCm39)	critical splice donor site	probably null
R9749:Itih3	UTSW	14	30,641,279 (GRCm39)	missense	probably damaging	1.00
Y5408:Itih3	UTSW	14	30,643,902 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTCCCTTGTGCAGAGTGTTC -3'
(R):5'- GCCCCTACTATTATGGTGAGTTG -3'

Sequencing Primer
(F):5'- CTCCCTTGTGCAGAGTGTTCTATAAG -3'
(R):5'- GTGAGTTGCTTGGCTCCTCC -3'

Posted On

2018-10-18