Incidental Mutation 'R6873:Gm6309'
ID536251
Institutional Source Beutler Lab
Gene Symbol Gm6309
Ensembl Gene ENSMUSG00000096798
Gene Namepredicted gene 6309
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R6873 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location146167976-146170721 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 146168188 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 305 (D305G)
Ref Sequence ENSEMBL: ENSMUSP00000134203 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000174320]
Predicted Effect probably damaging
Transcript: ENSMUST00000174320
AA Change: D305G

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000134203
Gene: ENSMUSG00000096798
AA Change: D305G

DomainStartEndE-ValueType
RasGEFN 65 181 3.29e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adssl1 A G 12: 112,632,704 D123G probably benign Het
Agbl4 A G 4: 111,566,659 D294G possibly damaging Het
Apob G T 12: 8,015,995 M4288I probably benign Het
Arnt T G 3: 95,474,575 F160V probably damaging Het
Atp5a1 C T 18: 77,775,840 R42* probably null Het
Bhlha15 A G 5: 144,191,385 D105G probably benign Het
C6 A G 15: 4,790,979 T491A probably benign Het
Caskin1 A G 17: 24,504,179 E647G probably benign Het
Col11a2 A G 17: 34,065,019 D1579G unknown Het
Dctn2 T G 10: 127,276,236 probably null Het
Eqtn A G 4: 94,927,021 V80A probably damaging Het
Etl4 A G 2: 20,797,992 probably null Het
Fam26e G C 10: 34,092,452 R202G probably damaging Het
Fbxo10 T C 4: 45,041,787 D814G possibly damaging Het
Galnt10 A G 11: 57,781,219 D445G probably damaging Het
Gm13762 T C 2: 88,973,424 T156A probably benign Het
Grap2 G A 15: 80,643,673 V107I probably damaging Het
Igsf10 C T 3: 59,328,444 A1439T probably benign Het
Krt5 G A 15: 101,712,877 probably benign Het
Lancl2 A G 6: 57,722,657 I152M possibly damaging Het
Mast3 A T 8: 70,786,592 C447* probably null Het
Mef2b A G 8: 70,166,307 I180V probably benign Het
Mon1b T C 8: 113,642,065 Y533H probably damaging Het
Mst1r A T 9: 107,911,644 H454L possibly damaging Het
Nhlrc4 G A 17: 25,943,522 Q84* probably null Het
Nlk A G 11: 78,590,948 I229T possibly damaging Het
Nlrp6 T C 7: 140,923,520 I513T probably benign Het
Olfr134 A T 17: 38,175,368 M95L probably benign Het
Olfr340 A T 2: 36,453,496 I304F probably benign Het
Panx1 A T 9: 15,010,217 Y121N probably damaging Het
Pfkfb4 A C 9: 109,010,335 probably null Het
Setbp1 A G 18: 78,859,559 S298P probably benign Het
Sh3bgr A C 16: 96,206,491 K19Q probably damaging Het
Slc35c2 T C 2: 165,282,809 D82G possibly damaging Het
Spata13 T A 14: 60,691,957 D321E probably benign Het
Stab2 A G 10: 86,861,366 probably null Het
Sulf2 T A 2: 166,089,275 I271F probably damaging Het
Sult2a5 A T 7: 13,625,386 I96L probably benign Het
Sv2b A G 7: 75,206,206 F112S probably damaging Het
Sycp1 G A 3: 102,840,980 T832I probably benign Het
Tm9sf2 A T 14: 122,145,113 E179V probably damaging Het
Tmem209 A G 6: 30,508,456 I66T probably damaging Het
Tspan10 T C 11: 120,444,723 W220R probably damaging Het
Ttc39b G C 4: 83,246,276 N266K probably damaging Het
Uri1 A T 7: 37,965,339 D309E probably benign Het
Zfhx3 C T 8: 108,800,641 R1057W probably damaging Het
Zfp318 GAAGAA GAAGAATAAGAA 17: 46,412,518 probably null Het
Zfp318 AGAAGA AGAAGACGAAGA 17: 46,412,526 probably benign Het
Other mutations in Gm6309
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01547:Gm6309 APN 5 146168411 missense probably benign 0.02
IGL01835:Gm6309 APN 5 146168275 missense probably damaging 0.99
FR4737:Gm6309 UTSW 5 146168183 missense probably benign
FR4976:Gm6309 UTSW 5 146168183 missense probably benign
R1513:Gm6309 UTSW 5 146170583 missense possibly damaging 0.83
R2022:Gm6309 UTSW 5 146168311 missense probably benign
R2191:Gm6309 UTSW 5 146168871 missense possibly damaging 0.93
R4735:Gm6309 UTSW 5 146168244 missense probably damaging 0.99
R5719:Gm6309 UTSW 5 146168182 missense probably benign 0.01
R5776:Gm6309 UTSW 5 146168881 missense possibly damaging 0.80
R5833:Gm6309 UTSW 5 146168318 missense probably damaging 1.00
R6246:Gm6309 UTSW 5 146170240 missense probably damaging 1.00
R6373:Gm6309 UTSW 5 146170275 missense probably damaging 0.97
R6912:Gm6309 UTSW 5 146168830 missense probably damaging 0.97
R6954:Gm6309 UTSW 5 146168490 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- CAAATCTTTGGTGCAGTCCATG -3'
(R):5'- AGCCACAATAGAGCTGCCTC -3'

Sequencing Primer
(F):5'- CTTTGGTGCAGTCCATGGGTAAAAC -3'
(R):5'- AGAGCTGCCTCTGTCTTTACATCAAG -3'
Posted On2018-10-18