Incidental Mutation 'R6874:Gm5591'
ID536309
Institutional Source Beutler Lab
Gene Symbol Gm5591
Ensembl Gene ENSMUSG00000060565
Gene Namepredicted gene 5591
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.187) question?
Stock #R6874 (G1)
Quality Score108.008
Status Not validated
Chromosome7
Chromosomal Location38518139-38528193 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 38520291 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 386 (E386G)
Ref Sequence ENSEMBL: ENSMUSP00000078695 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079759]
Predicted Effect probably damaging
Transcript: ENSMUST00000079759
AA Change: E386G

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000078695
Gene: ENSMUSG00000060565
AA Change: E386G

DomainStartEndE-ValueType
low complexity region 319 330 N/A INTRINSIC
Pfam:DUF4629 437 582 1.2e-59 PFAM
low complexity region 648 660 N/A INTRINSIC
low complexity region 693 704 N/A INTRINSIC
low complexity region 711 723 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A G 7: 120,252,205 D802G possibly damaging Het
Acsl5 A G 19: 55,291,863 T523A probably damaging Het
Adamts7 A T 9: 90,188,731 D635V probably damaging Het
Akr1c12 C A 13: 4,272,960 G217C probably benign Het
Astn1 C A 1: 158,664,074 S1007* probably null Het
Cntln T C 4: 85,067,759 L988P probably damaging Het
Dcps A T 9: 35,175,967 M1K probably null Het
Dnaic1 T A 4: 41,632,412 L582Q probably damaging Het
Dst A T 1: 34,289,651 Q7118L probably benign Het
Ehd2 T A 7: 15,950,438 T479S probably benign Het
Fbxl7 T C 15: 26,552,942 I80V probably benign Het
Fry T C 5: 150,437,303 V125A probably benign Het
Gm12695 A T 4: 96,785,069 I31K probably benign Het
Helz G T 11: 107,663,634 R1219S probably damaging Het
Hes3 G T 4: 152,287,238 P85T possibly damaging Het
Igkv3-2 A T 6: 70,698,838 R44* probably null Het
Igsf9 A G 1: 172,494,529 T496A probably benign Het
Irf2bp1 G T 7: 19,005,217 A261S possibly damaging Het
Jph2 G A 2: 163,339,487 P586S probably benign Het
Klhl11 T C 11: 100,472,205 H175R probably benign Het
Ksr2 G T 5: 117,756,336 E847* probably null Het
Lats1 T A 10: 7,710,851 Y926N probably damaging Het
Lmbr1 A T 5: 29,292,906 L33H probably damaging Het
Lrp10 T C 14: 54,468,213 S287P possibly damaging Het
Map3k6 G A 4: 133,250,656 E976K probably benign Het
Mfsd6 T A 1: 52,660,709 D760V probably benign Het
Muc16 G T 9: 18,658,769 S818* probably null Het
Muc5ac C T 7: 141,809,744 probably benign Het
Nagpa T C 16: 5,196,057 T306A probably benign Het
Nisch G T 14: 31,176,684 probably benign Het
Nrxn3 T C 12: 90,332,190 V1028A probably damaging Het
Nucb1 T C 7: 45,503,194 N75S probably benign Het
Olfr1058 C T 2: 86,385,528 V297I possibly damaging Het
Olfr191 T A 16: 59,085,949 Y178F probably benign Het
Olfr396-ps1 T G 11: 73,928,242 M6R probably null Het
Olfr644 T A 7: 104,068,189 I281F possibly damaging Het
Olfr832 T A 9: 18,945,481 Y278N possibly damaging Het
Olfr96 T C 17: 37,225,347 V74A probably benign Het
Olfr983 A G 9: 40,092,726 V80A probably benign Het
Pik3c2a A G 7: 116,394,305 L409S probably damaging Het
Pkhd1l1 T A 15: 44,589,527 D3949E probably benign Het
Prune2 C A 19: 17,123,228 P2032Q probably damaging Het
Ptms T C 6: 124,914,231 probably benign Het
Ptp4a3 A G 15: 73,723,410 probably benign Het
Ptprq T C 10: 107,718,599 I88M possibly damaging Het
Radil T A 5: 142,506,802 D357V probably damaging Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Supt20 A G 3: 54,727,754 probably null Het
Thoc5 T C 11: 4,901,261 I69T probably damaging Het
Trib2 G C 12: 15,815,337 S79W probably damaging Het
Trpc6 A G 9: 8,680,438 D889G probably damaging Het
Usf3 T C 16: 44,219,740 S1528P probably benign Het
Vax1 A T 19: 59,168,523 V126E unknown Het
Vgf A G 5: 137,031,532 probably benign Het
Vmn2r1 T A 3: 64,104,955 C746S probably damaging Het
Vmn2r77 A G 7: 86,802,078 T391A probably benign Het
Zfp738 C A 13: 67,670,263 E536D possibly damaging Het
Other mutations in Gm5591
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Gm5591 APN 7 38520414 missense probably benign 0.20
IGL02277:Gm5591 APN 7 38520432 missense probably damaging 0.98
IGL02277:Gm5591 APN 7 38519038 missense possibly damaging 0.92
IGL02503:Gm5591 APN 7 38520009 missense probably damaging 1.00
IGL02897:Gm5591 APN 7 38520042 missense probably damaging 1.00
IGL02899:Gm5591 APN 7 38519418 missense probably damaging 1.00
R1599:Gm5591 UTSW 7 38520370 missense probably benign
R2365:Gm5591 UTSW 7 38519401 missense probably damaging 1.00
R3054:Gm5591 UTSW 7 38520634 missense probably benign 0.35
R4619:Gm5591 UTSW 7 38520648 missense probably benign 0.04
R4722:Gm5591 UTSW 7 38519148 missense probably damaging 1.00
R4779:Gm5591 UTSW 7 38522256 missense probably damaging 0.96
R5079:Gm5591 UTSW 7 38522136 missense probably benign 0.01
R5237:Gm5591 UTSW 7 38522207 missense probably benign 0.31
R5267:Gm5591 UTSW 7 38518914 missense possibly damaging 0.94
R6337:Gm5591 UTSW 7 38521895 missense probably benign 0.00
R6458:Gm5591 UTSW 7 38519035 missense probably damaging 1.00
R6671:Gm5591 UTSW 7 38520099 missense possibly damaging 0.71
R6709:Gm5591 UTSW 7 38522075 missense probably benign 0.31
R6917:Gm5591 UTSW 7 38522190 missense probably damaging 0.99
R6993:Gm5591 UTSW 7 38519223 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTCACCTTTTCAGAGGAGCTG -3'
(R):5'- AATTCATGACCTTGCCTCTAGC -3'

Sequencing Primer
(F):5'- TTCAGAGGAGCTGCTCATGACTC -3'
(R):5'- GCCTCTAGCTCCAATCCTGG -3'
Posted On2018-10-18