Incidental Mutation 'R6875:Olfr1305'
ID536350
Institutional Source Beutler Lab
Gene Symbol Olfr1305
Ensembl Gene ENSMUSG00000074955
Gene Nameolfactory receptor 1305
SynonymsMOR245-8, GA_x6K02T2Q125-72930843-72929905
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R6875 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location111867657-111877149 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 111872961 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 298 (I298N)
Ref Sequence ENSEMBL: ENSMUSP00000149852 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099608] [ENSMUST00000213405] [ENSMUST00000213737]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099608
AA Change: I298N

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000097203
Gene: ENSMUSG00000074955
AA Change: I298N

DomainStartEndE-ValueType
Pfam:7tm_4 31 305 1.4e-41 PFAM
Pfam:7TM_GPCR_Srsx 35 302 6.8e-7 PFAM
Pfam:7tm_1 41 287 4.1e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213405
AA Change: I298N

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000213737
AA Change: I298N

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)
Meta Mutation Damage Score 0.0524 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030458C11Rik T C 15: 12,812,068 H270R probably damaging Het
Abcb1a T C 5: 8,701,628 I336T probably benign Het
Adam19 T A 11: 46,112,875 F177I probably benign Het
Ankrd53 T C 6: 83,768,173 V455A probably damaging Het
Arrdc1 A G 2: 24,925,665 S415P probably benign Het
Atp10a T C 7: 58,797,352 L614P probably benign Het
C130060K24Rik A T 6: 65,456,336 N380I probably benign Het
Catsper1 G T 19: 5,343,963 V668F probably damaging Het
Cluh T A 11: 74,661,918 D596E probably damaging Het
Cnot10 A G 9: 114,615,107 S407P probably benign Het
Commd6 T C 14: 101,634,350 T86A probably damaging Het
D5Ertd579e A T 5: 36,604,657 probably null Het
Eif3l A G 15: 79,085,560 D252G probably damaging Het
Epha2 A T 4: 141,328,468 S962C probably damaging Het
Fcho1 C A 8: 71,714,425 probably null Het
Fgf23 G T 6: 127,073,216 G63C probably damaging Het
Flnc A T 6: 29,445,749 Y834F probably damaging Het
Gcn1l1 T C 5: 115,588,110 L608P probably damaging Het
Hdac5 T A 11: 102,202,276 E545V probably damaging Het
Hecw2 A T 1: 53,937,132 M166K probably benign Het
Ikbkb T C 8: 22,665,893 D586G probably damaging Het
Il1f9 G C 2: 24,188,621 probably null Het
Ipo13 A T 4: 117,904,911 I422N possibly damaging Het
Iqgap3 GGAGAG GGAG 3: 88,112,771 probably null Het
Kat6a G A 8: 22,932,361 A896T probably benign Het
Kif28 A G 1: 179,735,994 I139T probably damaging Het
Klhl25 A G 7: 75,866,342 E332G probably damaging Het
Krt8 C T 15: 101,997,908 A389T probably benign Het
Msrb3 T C 10: 120,784,106 S175G probably benign Het
Muc5ac C T 7: 141,809,744 probably benign Het
Myo10 T C 15: 25,805,659 Y1709H probably benign Het
Nckap5 A G 1: 126,023,194 S1519P probably benign Het
Npnt T A 3: 132,909,910 D124V probably damaging Het
Nr1d1 A T 11: 98,770,836 probably null Het
Ogdh A G 11: 6,340,477 Y365C probably benign Het
Phf21b A T 15: 84,787,446 C416S probably damaging Het
Prpsap1 A G 11: 116,471,438 S373P probably damaging Het
Rab28 T C 5: 41,703,534 T26A probably damaging Het
Rbbp8nl A G 2: 180,279,226 I455T probably benign Het
Rnft2 G A 5: 118,228,818 A285V possibly damaging Het
Rrp36 G T 17: 46,672,371 Q106K probably benign Het
Rsf1 CG CGACGGCGGAG 7: 97,579,908 probably benign Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Scn5a A G 9: 119,486,644 L1666P probably damaging Het
Siglecf A C 7: 43,355,200 T318P probably benign Het
Slc22a1 C T 17: 12,667,305 W147* probably null Het
Smchd1 T C 17: 71,353,506 I1868V probably damaging Het
Snx21 A G 2: 164,791,902 S203G probably damaging Het
Srl T C 16: 4,482,831 K792R probably benign Het
Srrt A G 5: 137,298,673 F100S probably benign Het
Stard9 G T 2: 120,697,436 M1391I probably benign Het
Syne2 A G 12: 76,035,630 E119G probably damaging Het
Syt11 G T 3: 88,762,155 S143R possibly damaging Het
Tiparp T A 3: 65,531,642 H126Q probably benign Het
Tulp2 C A 7: 45,518,614 T150K probably benign Het
Ugt2b37 T A 5: 87,242,429 Y386F probably benign Het
Usp31 C T 7: 121,649,640 W860* probably null Het
Zfp317 A G 9: 19,643,665 R30G probably damaging Het
Zfp709 C A 8: 71,889,007 N93K possibly damaging Het
Other mutations in Olfr1305
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Olfr1305 APN 2 111872950 missense probably benign 0.03
IGL02198:Olfr1305 APN 2 111873248 missense probably damaging 1.00
IGL02277:Olfr1305 APN 2 111873580 missense possibly damaging 0.91
IGL02302:Olfr1305 APN 2 111873542 missense possibly damaging 0.76
IGL03348:Olfr1305 APN 2 111873148 missense probably damaging 0.99
PIT4131001:Olfr1305 UTSW 2 111873304 missense probably benign 0.02
R2144:Olfr1305 UTSW 2 111873423 missense probably damaging 0.96
R2860:Olfr1305 UTSW 2 111873473 nonsense probably null
R2861:Olfr1305 UTSW 2 111873473 nonsense probably null
R3785:Olfr1305 UTSW 2 111873486 missense probably damaging 0.99
R4474:Olfr1305 UTSW 2 111873439 missense possibly damaging 0.52
R4508:Olfr1305 UTSW 2 111873602 missense probably damaging 1.00
R4540:Olfr1305 UTSW 2 111873201 missense probably damaging 1.00
R4783:Olfr1305 UTSW 2 111873050 missense possibly damaging 0.95
R4784:Olfr1305 UTSW 2 111873050 missense possibly damaging 0.95
R4785:Olfr1305 UTSW 2 111873050 missense possibly damaging 0.95
R5410:Olfr1305 UTSW 2 111873292 missense probably damaging 1.00
R5491:Olfr1305 UTSW 2 111873562 missense probably benign 0.44
R7185:Olfr1305 UTSW 2 111873822 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CCTAACAGGAGGTGATTGCC -3'
(R):5'- TGATTACTGCCAATAGTGGGTTC -3'

Sequencing Primer
(F):5'- CCTGAATGTGCTCAAAGGGTCTC -3'
(R):5'- TCAGGATGTTCATCCAAGGC -3'
Posted On2018-10-18