Incidental Mutation 'R6875:Rbbp8nl'
ID536353
Institutional Source Beutler Lab
Gene Symbol Rbbp8nl
Ensembl Gene ENSMUSG00000038980
Gene NameRBBP8 N-terminal like
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R6875 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location180277646-180289879 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 180279226 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 455 (I455T)
Ref Sequence ENSEMBL: ENSMUSP00000047237 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038529]
Predicted Effect probably benign
Transcript: ENSMUST00000038529
AA Change: I455T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000047237
Gene: ENSMUSG00000038980
AA Change: I455T

DomainStartEndE-ValueType
Pfam:CtIP_N 4 123 5.6e-56 PFAM
low complexity region 143 154 N/A INTRINSIC
low complexity region 157 172 N/A INTRINSIC
low complexity region 237 250 N/A INTRINSIC
low complexity region 282 296 N/A INTRINSIC
low complexity region 352 361 N/A INTRINSIC
low complexity region 365 379 N/A INTRINSIC
low complexity region 585 590 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 98% (58/59)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030458C11Rik T C 15: 12,812,068 H270R probably damaging Het
Abcb1a T C 5: 8,701,628 I336T probably benign Het
Adam19 T A 11: 46,112,875 F177I probably benign Het
Ankrd53 T C 6: 83,768,173 V455A probably damaging Het
Arrdc1 A G 2: 24,925,665 S415P probably benign Het
Atp10a T C 7: 58,797,352 L614P probably benign Het
C130060K24Rik A T 6: 65,456,336 N380I probably benign Het
Catsper1 G T 19: 5,343,963 V668F probably damaging Het
Cluh T A 11: 74,661,918 D596E probably damaging Het
Cnot10 A G 9: 114,615,107 S407P probably benign Het
Commd6 T C 14: 101,634,350 T86A probably damaging Het
D5Ertd579e A T 5: 36,604,657 probably null Het
Eif3l A G 15: 79,085,560 D252G probably damaging Het
Epha2 A T 4: 141,328,468 S962C probably damaging Het
Fcho1 C A 8: 71,714,425 probably null Het
Fgf23 G T 6: 127,073,216 G63C probably damaging Het
Flnc A T 6: 29,445,749 Y834F probably damaging Het
Gcn1l1 T C 5: 115,588,110 L608P probably damaging Het
Hdac5 T A 11: 102,202,276 E545V probably damaging Het
Hecw2 A T 1: 53,937,132 M166K probably benign Het
Ikbkb T C 8: 22,665,893 D586G probably damaging Het
Il1f9 G C 2: 24,188,621 probably null Het
Ipo13 A T 4: 117,904,911 I422N possibly damaging Het
Iqgap3 GGAGAG GGAG 3: 88,112,771 probably null Het
Kat6a G A 8: 22,932,361 A896T probably benign Het
Kif28 A G 1: 179,735,994 I139T probably damaging Het
Klhl25 A G 7: 75,866,342 E332G probably damaging Het
Krt8 C T 15: 101,997,908 A389T probably benign Het
Msrb3 T C 10: 120,784,106 S175G probably benign Het
Muc5ac C T 7: 141,809,744 probably benign Het
Myo10 T C 15: 25,805,659 Y1709H probably benign Het
Nckap5 A G 1: 126,023,194 S1519P probably benign Het
Npnt T A 3: 132,909,910 D124V probably damaging Het
Nr1d1 A T 11: 98,770,836 probably null Het
Ogdh A G 11: 6,340,477 Y365C probably benign Het
Olfr1305 A T 2: 111,872,961 I298N possibly damaging Het
Phf21b A T 15: 84,787,446 C416S probably damaging Het
Prpsap1 A G 11: 116,471,438 S373P probably damaging Het
Rab28 T C 5: 41,703,534 T26A probably damaging Het
Rnft2 G A 5: 118,228,818 A285V possibly damaging Het
Rrp36 G T 17: 46,672,371 Q106K probably benign Het
Rsf1 CG CGACGGCGGAG 7: 97,579,908 probably benign Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Scn5a A G 9: 119,486,644 L1666P probably damaging Het
Siglecf A C 7: 43,355,200 T318P probably benign Het
Slc22a1 C T 17: 12,667,305 W147* probably null Het
Smchd1 T C 17: 71,353,506 I1868V probably damaging Het
Snx21 A G 2: 164,791,902 S203G probably damaging Het
Srl T C 16: 4,482,831 K792R probably benign Het
Srrt A G 5: 137,298,673 F100S probably benign Het
Stard9 G T 2: 120,697,436 M1391I probably benign Het
Syne2 A G 12: 76,035,630 E119G probably damaging Het
Syt11 G T 3: 88,762,155 S143R possibly damaging Het
Tiparp T A 3: 65,531,642 H126Q probably benign Het
Tulp2 C A 7: 45,518,614 T150K probably benign Het
Ugt2b37 T A 5: 87,242,429 Y386F probably benign Het
Usp31 C T 7: 121,649,640 W860* probably null Het
Zfp317 A G 9: 19,643,665 R30G probably damaging Het
Zfp709 C A 8: 71,889,007 N93K possibly damaging Het
Other mutations in Rbbp8nl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01802:Rbbp8nl APN 2 180279695 missense probably benign 0.01
IGL01845:Rbbp8nl APN 2 180283311 missense probably damaging 0.99
IGL01966:Rbbp8nl APN 2 180280989 splice site probably benign
IGL02217:Rbbp8nl APN 2 180278188 unclassified probably benign
IGL02500:Rbbp8nl APN 2 180279329 missense possibly damaging 0.57
IGL02623:Rbbp8nl APN 2 180281443 missense probably damaging 0.99
IGL02634:Rbbp8nl APN 2 180280895 missense probably benign 0.00
F5770:Rbbp8nl UTSW 2 180278208 missense probably benign 0.03
R0380:Rbbp8nl UTSW 2 180281719 missense probably damaging 0.96
R1773:Rbbp8nl UTSW 2 180281194 missense probably benign 0.00
R1858:Rbbp8nl UTSW 2 180282213 splice site probably benign
R1901:Rbbp8nl UTSW 2 180283313 missense probably damaging 1.00
R1962:Rbbp8nl UTSW 2 180280874 missense probably benign 0.03
R2423:Rbbp8nl UTSW 2 180280971 missense probably damaging 0.98
R2495:Rbbp8nl UTSW 2 180279102 missense probably null 0.31
R3738:Rbbp8nl UTSW 2 180281248 missense probably benign 0.37
R4460:Rbbp8nl UTSW 2 180280971 missense probably benign 0.41
R4502:Rbbp8nl UTSW 2 180279196 missense possibly damaging 0.48
R5573:Rbbp8nl UTSW 2 180279793 missense possibly damaging 0.95
R5699:Rbbp8nl UTSW 2 180278668 missense probably damaging 0.98
R6242:Rbbp8nl UTSW 2 180280974 missense probably damaging 1.00
R6269:Rbbp8nl UTSW 2 180281512 nonsense probably null
R6586:Rbbp8nl UTSW 2 180280959 missense probably damaging 1.00
V7581:Rbbp8nl UTSW 2 180278208 missense probably benign 0.03
V7582:Rbbp8nl UTSW 2 180278208 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ATACTACCTACCCTGCAGTGGAG -3'
(R):5'- TTCTGAGGGCTCTGACAGTG -3'

Sequencing Primer
(F):5'- TGGAGCTGCATAGAGGCTG -3'
(R):5'- TCTGAGTACAGAGGCCCAG -3'
Posted On2018-10-18