Incidental Mutation 'R6875:Gcn1l1'
ID536364
Institutional Source Beutler Lab
Gene Symbol Gcn1l1
Ensembl Gene ENSMUSG00000041638
Gene NameGCN1 general control of amino-acid synthesis 1-like 1 (yeast)
SynonymsGCN1L, G431004K08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.953) question?
Stock #R6875 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location115565254-115622654 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 115588110 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 608 (L608P)
Ref Sequence ENSEMBL: ENSMUSP00000069432 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064454]
Predicted Effect probably damaging
Transcript: ENSMUST00000064454
AA Change: L608P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000069432
Gene: ENSMUSG00000041638
AA Change: L608P

DomainStartEndE-ValueType
low complexity region 64 84 N/A INTRINSIC
low complexity region 108 117 N/A INTRINSIC
low complexity region 142 154 N/A INTRINSIC
Pfam:DUF3554 357 705 2e-61 PFAM
coiled coil region 806 866 N/A INTRINSIC
Blast:ARM 1028 1068 6e-11 BLAST
coiled coil region 1180 1203 N/A INTRINSIC
low complexity region 1457 1466 N/A INTRINSIC
low complexity region 1501 1510 N/A INTRINSIC
ARM 1527 1567 3.69e1 SMART
Blast:ARM 1602 1644 1e-5 BLAST
Blast:EZ_HEAT 1671 1704 1e-7 BLAST
low complexity region 1926 1934 N/A INTRINSIC
low complexity region 1956 1972 N/A INTRINSIC
ARM 2034 2070 9.27e1 SMART
low complexity region 2326 2334 N/A INTRINSIC
ARM 2416 2455 2.16e1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 98% (58/59)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030458C11Rik T C 15: 12,812,068 H270R probably damaging Het
Abcb1a T C 5: 8,701,628 I336T probably benign Het
Adam19 T A 11: 46,112,875 F177I probably benign Het
Ankrd53 T C 6: 83,768,173 V455A probably damaging Het
Arrdc1 A G 2: 24,925,665 S415P probably benign Het
Atp10a T C 7: 58,797,352 L614P probably benign Het
C130060K24Rik A T 6: 65,456,336 N380I probably benign Het
Catsper1 G T 19: 5,343,963 V668F probably damaging Het
Cluh T A 11: 74,661,918 D596E probably damaging Het
Cnot10 A G 9: 114,615,107 S407P probably benign Het
Commd6 T C 14: 101,634,350 T86A probably damaging Het
D5Ertd579e A T 5: 36,604,657 probably null Het
Eif3l A G 15: 79,085,560 D252G probably damaging Het
Epha2 A T 4: 141,328,468 S962C probably damaging Het
Fcho1 C A 8: 71,714,425 probably null Het
Fgf23 G T 6: 127,073,216 G63C probably damaging Het
Flnc A T 6: 29,445,749 Y834F probably damaging Het
Hdac5 T A 11: 102,202,276 E545V probably damaging Het
Hecw2 A T 1: 53,937,132 M166K probably benign Het
Ikbkb T C 8: 22,665,893 D586G probably damaging Het
Il1f9 G C 2: 24,188,621 probably null Het
Ipo13 A T 4: 117,904,911 I422N possibly damaging Het
Iqgap3 GGAGAG GGAG 3: 88,112,771 probably null Het
Kat6a G A 8: 22,932,361 A896T probably benign Het
Kif28 A G 1: 179,735,994 I139T probably damaging Het
Klhl25 A G 7: 75,866,342 E332G probably damaging Het
Krt8 C T 15: 101,997,908 A389T probably benign Het
Msrb3 T C 10: 120,784,106 S175G probably benign Het
Muc5ac C T 7: 141,809,744 probably benign Het
Myo10 T C 15: 25,805,659 Y1709H probably benign Het
Nckap5 A G 1: 126,023,194 S1519P probably benign Het
Npnt T A 3: 132,909,910 D124V probably damaging Het
Nr1d1 A T 11: 98,770,836 probably null Het
Ogdh A G 11: 6,340,477 Y365C probably benign Het
Olfr1305 A T 2: 111,872,961 I298N possibly damaging Het
Phf21b A T 15: 84,787,446 C416S probably damaging Het
Prpsap1 A G 11: 116,471,438 S373P probably damaging Het
Rab28 T C 5: 41,703,534 T26A probably damaging Het
Rbbp8nl A G 2: 180,279,226 I455T probably benign Het
Rnft2 G A 5: 118,228,818 A285V possibly damaging Het
Rrp36 G T 17: 46,672,371 Q106K probably benign Het
Rsf1 CG CGACGGCGGAG 7: 97,579,908 probably benign Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Scn5a A G 9: 119,486,644 L1666P probably damaging Het
Siglecf A C 7: 43,355,200 T318P probably benign Het
Slc22a1 C T 17: 12,667,305 W147* probably null Het
Smchd1 T C 17: 71,353,506 I1868V probably damaging Het
Snx21 A G 2: 164,791,902 S203G probably damaging Het
Srl T C 16: 4,482,831 K792R probably benign Het
Srrt A G 5: 137,298,673 F100S probably benign Het
Stard9 G T 2: 120,697,436 M1391I probably benign Het
Syne2 A G 12: 76,035,630 E119G probably damaging Het
Syt11 G T 3: 88,762,155 S143R possibly damaging Het
Tiparp T A 3: 65,531,642 H126Q probably benign Het
Tulp2 C A 7: 45,518,614 T150K probably benign Het
Ugt2b37 T A 5: 87,242,429 Y386F probably benign Het
Usp31 C T 7: 121,649,640 W860* probably null Het
Zfp317 A G 9: 19,643,665 R30G probably damaging Het
Zfp709 C A 8: 71,889,007 N93K possibly damaging Het
Other mutations in Gcn1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00869:Gcn1l1 APN 5 115588143 splice site probably benign
IGL00974:Gcn1l1 APN 5 115613793 missense possibly damaging 0.88
IGL01566:Gcn1l1 APN 5 115611058 missense probably damaging 1.00
IGL01843:Gcn1l1 APN 5 115619700 missense probably damaging 1.00
IGL01885:Gcn1l1 APN 5 115576115 splice site probably null
IGL02081:Gcn1l1 APN 5 115585871 missense probably damaging 1.00
IGL02118:Gcn1l1 APN 5 115610879 missense probably damaging 1.00
IGL02150:Gcn1l1 APN 5 115609868 missense probably damaging 1.00
IGL02190:Gcn1l1 APN 5 115614124 missense probably damaging 1.00
IGL02219:Gcn1l1 APN 5 115613767 missense possibly damaging 0.68
IGL02507:Gcn1l1 APN 5 115585881 missense probably benign 0.11
IGL02644:Gcn1l1 APN 5 115575191 missense probably benign
IGL02678:Gcn1l1 APN 5 115613755 missense probably damaging 0.99
IGL02748:Gcn1l1 APN 5 115610800 splice site probably null
IGL02755:Gcn1l1 APN 5 115604006 splice site probably null
IGL02896:Gcn1l1 APN 5 115619648 splice site probably benign
IGL03147:Gcn1l1 UTSW 5 115610858 missense possibly damaging 0.78
R0362:Gcn1l1 UTSW 5 115576108 splice site probably benign
R0540:Gcn1l1 UTSW 5 115588956 missense probably benign 0.00
R0569:Gcn1l1 UTSW 5 115595059 missense probably benign 0.00
R0570:Gcn1l1 UTSW 5 115592421 missense probably damaging 1.00
R0584:Gcn1l1 UTSW 5 115595015 missense probably damaging 1.00
R0630:Gcn1l1 UTSW 5 115581089 missense probably benign 0.06
R0656:Gcn1l1 UTSW 5 115589303 missense probably benign 0.27
R0801:Gcn1l1 UTSW 5 115591006 missense probably benign 0.12
R0890:Gcn1l1 UTSW 5 115579793 missense possibly damaging 0.77
R1400:Gcn1l1 UTSW 5 115614161 missense probably damaging 1.00
R1485:Gcn1l1 UTSW 5 115574617 missense probably benign
R1574:Gcn1l1 UTSW 5 115615552 missense probably benign
R1574:Gcn1l1 UTSW 5 115615552 missense probably benign
R1673:Gcn1l1 UTSW 5 115582297 missense probably benign
R1894:Gcn1l1 UTSW 5 115589115 missense probably damaging 1.00
R2114:Gcn1l1 UTSW 5 115598825 missense probably benign 0.35
R2116:Gcn1l1 UTSW 5 115598825 missense probably benign 0.35
R2117:Gcn1l1 UTSW 5 115598825 missense probably benign 0.35
R2152:Gcn1l1 UTSW 5 115609829 missense probably benign 0.07
R2162:Gcn1l1 UTSW 5 115592132 missense probably benign 0.18
R2216:Gcn1l1 UTSW 5 115593661 missense probably benign
R2218:Gcn1l1 UTSW 5 115619661 missense probably benign 0.04
R2278:Gcn1l1 UTSW 5 115611175 missense probably damaging 1.00
R2280:Gcn1l1 UTSW 5 115612730 missense probably damaging 1.00
R3719:Gcn1l1 UTSW 5 115579817 missense probably benign 0.03
R3729:Gcn1l1 UTSW 5 115583394 splice site probably benign
R3833:Gcn1l1 UTSW 5 115592132 missense probably benign 0.18
R3932:Gcn1l1 UTSW 5 115587834 missense probably benign 0.11
R4067:Gcn1l1 UTSW 5 115599088 missense probably damaging 1.00
R4152:Gcn1l1 UTSW 5 115613354 critical splice acceptor site probably null
R4179:Gcn1l1 UTSW 5 115588050 missense probably benign 0.00
R4292:Gcn1l1 UTSW 5 115576148 missense possibly damaging 0.49
R4350:Gcn1l1 UTSW 5 115603330 missense probably damaging 1.00
R4493:Gcn1l1 UTSW 5 115594144 missense probably benign
R4672:Gcn1l1 UTSW 5 115606520 missense probably damaging 1.00
R4749:Gcn1l1 UTSW 5 115614402 missense probably benign
R4753:Gcn1l1 UTSW 5 115616478 missense probably benign
R4826:Gcn1l1 UTSW 5 115593693 missense probably benign
R4873:Gcn1l1 UTSW 5 115576170 missense possibly damaging 0.92
R4875:Gcn1l1 UTSW 5 115576170 missense possibly damaging 0.92
R4932:Gcn1l1 UTSW 5 115592144 missense probably benign 0.00
R4992:Gcn1l1 UTSW 5 115599166 missense probably benign 0.29
R5049:Gcn1l1 UTSW 5 115606671 missense probably damaging 1.00
R5211:Gcn1l1 UTSW 5 115619312 missense probably benign 0.04
R5226:Gcn1l1 UTSW 5 115588067 missense probably benign 0.01
R5338:Gcn1l1 UTSW 5 115583403 missense probably benign 0.00
R5914:Gcn1l1 UTSW 5 115610135 synonymous silent
R5932:Gcn1l1 UTSW 5 115592376 missense possibly damaging 0.77
R6422:Gcn1l1 UTSW 5 115609544 missense probably damaging 1.00
R6435:Gcn1l1 UTSW 5 115611022 critical splice acceptor site probably null
R6607:Gcn1l1 UTSW 5 115609478 missense probably damaging 0.98
R6724:Gcn1l1 UTSW 5 115609158 intron probably null
R6861:Gcn1l1 UTSW 5 115611049 missense probably benign
R6910:Gcn1l1 UTSW 5 115606538 missense probably benign 0.42
R6975:Gcn1l1 UTSW 5 115613459 missense probably damaging 1.00
R7027:Gcn1l1 UTSW 5 115616546 critical splice donor site probably null
R7038:Gcn1l1 UTSW 5 115611144 missense probably damaging 1.00
R7171:Gcn1l1 UTSW 5 115590293 missense probably benign 0.02
R7276:Gcn1l1 UTSW 5 115611060 missense probably damaging 1.00
R7456:Gcn1l1 UTSW 5 115604946 nonsense probably null
R7473:Gcn1l1 UTSW 5 115581804 missense probably benign 0.09
R7517:Gcn1l1 UTSW 5 115619696 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCCAGTATGTGAGCCCCTTG -3'
(R):5'- CATTTTGGTTGAACAAAGGGAAGAC -3'

Sequencing Primer
(F):5'- TATGTGAGCCCCTTGAGCCC -3'
(R):5'- AGACGGGCTCTAAAGGGC -3'
Posted On2018-10-18