Incidental Mutation 'R6875:Zfp709'
ID536381
Institutional Source Beutler Lab
Gene Symbol Zfp709
Ensembl Gene ENSMUSG00000056019
Gene Namezinc finger protein 709
SynonymsGIOT-4
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.234) question?
Stock #R6875 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location71882019-71895727 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 71889007 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 93 (N93K)
Ref Sequence ENSEMBL: ENSMUSP00000140285 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034259] [ENSMUST00000188374] [ENSMUST00000188685]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034259
AA Change: N92K

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000034259
Gene: ENSMUSG00000056019
AA Change: N92K

DomainStartEndE-ValueType
KRAB 3 68 3.08e-15 SMART
ZnF_C2H2 224 246 6.78e-3 SMART
ZnF_C2H2 252 274 2.09e-3 SMART
ZnF_C2H2 280 302 2.05e-2 SMART
ZnF_C2H2 308 330 2.4e-3 SMART
ZnF_C2H2 336 358 1.36e-2 SMART
ZnF_C2H2 364 386 1.36e-2 SMART
ZnF_C2H2 392 414 1.69e-3 SMART
ZnF_C2H2 420 442 5.14e-3 SMART
ZnF_C2H2 448 470 1.67e-2 SMART
ZnF_C2H2 476 498 1.1e-2 SMART
ZnF_C2H2 504 526 2.86e-1 SMART
ZnF_C2H2 532 554 7.26e-3 SMART
ZnF_C2H2 560 582 8.34e-3 SMART
ZnF_C2H2 588 610 1.5e-4 SMART
ZnF_C2H2 616 638 1.18e-2 SMART
ZnF_C2H2 644 666 1.06e-4 SMART
ZnF_C2H2 672 694 1.18e-2 SMART
ZnF_C2H2 700 722 8.94e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188374
SMART Domains Protein: ENSMUSP00000141000
Gene: ENSMUSG00000056019

DomainStartEndE-ValueType
KRAB 4 56 9.2e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000188685
AA Change: N93K

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000140285
Gene: ENSMUSG00000056019
AA Change: N93K

DomainStartEndE-ValueType
KRAB 4 69 3.08e-15 SMART
ZnF_C2H2 225 247 6.78e-3 SMART
ZnF_C2H2 253 275 2.09e-3 SMART
ZnF_C2H2 281 303 2.05e-2 SMART
ZnF_C2H2 309 331 2.4e-3 SMART
ZnF_C2H2 337 359 1.36e-2 SMART
ZnF_C2H2 365 387 1.36e-2 SMART
ZnF_C2H2 393 415 1.69e-3 SMART
ZnF_C2H2 421 443 5.14e-3 SMART
ZnF_C2H2 449 471 1.67e-2 SMART
ZnF_C2H2 477 499 1.1e-2 SMART
ZnF_C2H2 505 527 2.86e-1 SMART
ZnF_C2H2 533 555 7.26e-3 SMART
ZnF_C2H2 561 583 8.34e-3 SMART
ZnF_C2H2 589 611 1.5e-4 SMART
ZnF_C2H2 617 639 1.18e-2 SMART
ZnF_C2H2 645 667 1.06e-4 SMART
ZnF_C2H2 673 695 1.18e-2 SMART
ZnF_C2H2 701 723 8.94e-3 SMART
Meta Mutation Damage Score 0.212 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Zinc finger proteins (ZNFs) bind DNA and, through this binding, regulate gene transcription. Most ZNFs contain conserved C2H2 motifs and are classified as Kruppel-type zinc fingers. For a general description of these proteins, see ZNF91 (MIM 603971).[supplied by OMIM, Jul 2002]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030458C11Rik T C 15: 12,812,068 H270R probably damaging Het
Abcb1a T C 5: 8,701,628 I336T probably benign Het
Adam19 T A 11: 46,112,875 F177I probably benign Het
Ankrd53 T C 6: 83,768,173 V455A probably damaging Het
Arrdc1 A G 2: 24,925,665 S415P probably benign Het
Atp10a T C 7: 58,797,352 L614P probably benign Het
C130060K24Rik A T 6: 65,456,336 N380I probably benign Het
Catsper1 G T 19: 5,343,963 V668F probably damaging Het
Cluh T A 11: 74,661,918 D596E probably damaging Het
Cnot10 A G 9: 114,615,107 S407P probably benign Het
Commd6 T C 14: 101,634,350 T86A probably damaging Het
D5Ertd579e A T 5: 36,604,657 probably null Het
Eif3l A G 15: 79,085,560 D252G probably damaging Het
Epha2 A T 4: 141,328,468 S962C probably damaging Het
Fcho1 C A 8: 71,714,425 probably null Het
Fgf23 G T 6: 127,073,216 G63C probably damaging Het
Flnc A T 6: 29,445,749 Y834F probably damaging Het
Gcn1l1 T C 5: 115,588,110 L608P probably damaging Het
Hdac5 T A 11: 102,202,276 E545V probably damaging Het
Hecw2 A T 1: 53,937,132 M166K probably benign Het
Ikbkb T C 8: 22,665,893 D586G probably damaging Het
Il1f9 G C 2: 24,188,621 probably null Het
Ipo13 A T 4: 117,904,911 I422N possibly damaging Het
Iqgap3 GGAGAG GGAG 3: 88,112,771 probably null Het
Kat6a G A 8: 22,932,361 A896T probably benign Het
Kif28 A G 1: 179,735,994 I139T probably damaging Het
Klhl25 A G 7: 75,866,342 E332G probably damaging Het
Krt8 C T 15: 101,997,908 A389T probably benign Het
Msrb3 T C 10: 120,784,106 S175G probably benign Het
Muc5ac C T 7: 141,809,744 probably benign Het
Myo10 T C 15: 25,805,659 Y1709H probably benign Het
Nckap5 A G 1: 126,023,194 S1519P probably benign Het
Npnt T A 3: 132,909,910 D124V probably damaging Het
Nr1d1 A T 11: 98,770,836 probably null Het
Ogdh A G 11: 6,340,477 Y365C probably benign Het
Olfr1305 A T 2: 111,872,961 I298N possibly damaging Het
Phf21b A T 15: 84,787,446 C416S probably damaging Het
Prpsap1 A G 11: 116,471,438 S373P probably damaging Het
Rab28 T C 5: 41,703,534 T26A probably damaging Het
Rbbp8nl A G 2: 180,279,226 I455T probably benign Het
Rnft2 G A 5: 118,228,818 A285V possibly damaging Het
Rrp36 G T 17: 46,672,371 Q106K probably benign Het
Rsf1 CG CGACGGCGGAG 7: 97,579,908 probably benign Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Scn5a A G 9: 119,486,644 L1666P probably damaging Het
Siglecf A C 7: 43,355,200 T318P probably benign Het
Slc22a1 C T 17: 12,667,305 W147* probably null Het
Smchd1 T C 17: 71,353,506 I1868V probably damaging Het
Snx21 A G 2: 164,791,902 S203G probably damaging Het
Srl T C 16: 4,482,831 K792R probably benign Het
Srrt A G 5: 137,298,673 F100S probably benign Het
Stard9 G T 2: 120,697,436 M1391I probably benign Het
Syne2 A G 12: 76,035,630 E119G probably damaging Het
Syt11 G T 3: 88,762,155 S143R possibly damaging Het
Tiparp T A 3: 65,531,642 H126Q probably benign Het
Tulp2 C A 7: 45,518,614 T150K probably benign Het
Ugt2b37 T A 5: 87,242,429 Y386F probably benign Het
Usp31 C T 7: 121,649,640 W860* probably null Het
Zfp317 A G 9: 19,643,665 R30G probably damaging Het
Other mutations in Zfp709
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03174:Zfp709 APN 8 71889026 missense probably benign 0.03
IGL03187:Zfp709 APN 8 71889282 missense probably benign 0.41
R0336:Zfp709 UTSW 8 71890605 missense probably damaging 1.00
R1386:Zfp709 UTSW 8 71890662 missense probably damaging 0.99
R1878:Zfp709 UTSW 8 71890047 missense probably damaging 1.00
R2279:Zfp709 UTSW 8 71889090 missense probably benign 0.31
R2320:Zfp709 UTSW 8 71887292 missense probably damaging 1.00
R2885:Zfp709 UTSW 8 71889705 missense probably benign 0.08
R3833:Zfp709 UTSW 8 71889062 missense probably benign 0.00
R3926:Zfp709 UTSW 8 71890553 missense probably damaging 1.00
R4165:Zfp709 UTSW 8 71890805 nonsense probably null
R4179:Zfp709 UTSW 8 71889906 missense probably damaging 1.00
R4963:Zfp709 UTSW 8 71889788 missense probably benign 0.27
R5340:Zfp709 UTSW 8 71889752 missense probably damaging 1.00
R5427:Zfp709 UTSW 8 71889132 missense probably benign 0.27
R5513:Zfp709 UTSW 8 71890056 missense probably damaging 1.00
R5639:Zfp709 UTSW 8 71889991 unclassified probably null
R5692:Zfp709 UTSW 8 71890155 missense probably damaging 1.00
R5872:Zfp709 UTSW 8 71889519 missense probably benign 0.03
R5940:Zfp709 UTSW 8 71890220 missense possibly damaging 0.85
R6192:Zfp709 UTSW 8 71890708 small deletion probably benign
R6210:Zfp709 UTSW 8 71890708 small deletion probably benign
R6225:Zfp709 UTSW 8 71890708 small deletion probably benign
R6227:Zfp709 UTSW 8 71890708 small deletion probably benign
R6228:Zfp709 UTSW 8 71890708 small deletion probably benign
R6246:Zfp709 UTSW 8 71890708 small deletion probably benign
R6247:Zfp709 UTSW 8 71890708 small deletion probably benign
R6248:Zfp709 UTSW 8 71890708 small deletion probably benign
R6249:Zfp709 UTSW 8 71890708 small deletion probably benign
R6250:Zfp709 UTSW 8 71890708 small deletion probably benign
R6258:Zfp709 UTSW 8 71890708 small deletion probably benign
R6259:Zfp709 UTSW 8 71890708 small deletion probably benign
R6371:Zfp709 UTSW 8 71889485 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTGTCTTCATATCCTGTAGAAC -3'
(R):5'- GCATTCTGGATAAATGAAGGCTTTC -3'

Sequencing Primer
(F):5'- CTTCATATCCTGTAGAACCTTCAATC -3'
(R):5'- AAATGAAGGCTTTCTCACATTCTCC -3'
Posted On2018-10-18