Incidental Mutation 'R6875:Runx2'
ID536401
Institutional Source Beutler Lab
Gene Symbol Runx2
Ensembl Gene ENSMUSG00000039153
Gene Namerunt related transcription factor 2
Synonymspolyomavirus enhancer binding factor 2 (PEBP2), Pebpa2a, AML3, Osf2, PEBP2aA, PEBP2 alpha A, Cbfa1, SL3-3 enhancer factor 1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6875 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location44495987-44814797 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 44814192 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 80 (P80L)
Ref Sequence ENSEMBL: ENSMUSP00000123743 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050630] [ENSMUST00000113568] [ENSMUST00000113571] [ENSMUST00000127798] [ENSMUST00000129416] [ENSMUST00000159943] [ENSMUST00000160673] [ENSMUST00000162629]
Predicted Effect probably benign
Transcript: ENSMUST00000050630
SMART Domains Protein: ENSMUSP00000050783
Gene: ENSMUSG00000038954

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
Pfam:TFIID-18kDa 24 116 4.5e-38 PFAM
low complexity region 274 294 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113568
AA Change: P80L

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000113571
AA Change: P12L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109201
Gene: ENSMUSG00000039153
AA Change: P12L

DomainStartEndE-ValueType
low complexity region 21 33 N/A INTRINSIC
coiled coil region 45 89 N/A INTRINSIC
Pfam:Runt 106 240 9.2e-83 PFAM
Pfam:RunxI 434 528 7.6e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127798
SMART Domains Protein: ENSMUSP00000121148
Gene: ENSMUSG00000038954

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
Pfam:TFIID-18kDa 24 116 9.3e-39 PFAM
low complexity region 274 294 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129416
SMART Domains Protein: ENSMUSP00000120197
Gene: ENSMUSG00000038954

DomainStartEndE-ValueType
Pfam:TFIID-18kDa 17 109 1e-38 PFAM
low complexity region 267 287 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130623
Predicted Effect probably damaging
Transcript: ENSMUST00000159943
AA Change: P12L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124918
Gene: ENSMUSG00000039153
AA Change: P12L

DomainStartEndE-ValueType
low complexity region 21 33 N/A INTRINSIC
coiled coil region 45 89 N/A INTRINSIC
Pfam:Runt 106 240 9.2e-83 PFAM
Pfam:RunxI 434 528 7.6e-45 PFAM
Predicted Effect
Predicted Effect probably damaging
Transcript: ENSMUST00000160673
AA Change: P80L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123743
Gene: ENSMUSG00000039153
AA Change: P80L

DomainStartEndE-ValueType
low complexity region 89 101 N/A INTRINSIC
coiled coil region 113 157 N/A INTRINSIC
Pfam:Runt 177 306 3.9e-75 PFAM
Pfam:RunxI 505 596 3.2e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161489
Predicted Effect probably damaging
Transcript: ENSMUST00000162629
AA Change: P12L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000124374
Gene: ENSMUSG00000039153
AA Change: P12L

DomainStartEndE-ValueType
low complexity region 21 33 N/A INTRINSIC
coiled coil region 45 89 N/A INTRINSIC
Pfam:Runt 106 240 3.5e-83 PFAM
Pfam:RunxI 412 506 2.7e-45 PFAM
Meta Mutation Damage Score 0.204 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: This gene encodes a member of the runt domain-containing family of transcription factors. This protein is essential for osteoblastic differentiation and skeletal morphogenesis and acts as a scaffold for nucleic acids and regulatory factors involved in skeletal gene expression. The protein can bind DNA both as a monomer or, with more affinity, as a subunit of a heterodimeric complex. Transcript variants that encode different protein isoforms result from the use of alternate promoters as well as alternate splicing. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal lethality, decreased body weight, abnormal hematopoiesis, and skeletal abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030458C11Rik T C 15: 12,812,068 H270R probably damaging Het
Abcb1a T C 5: 8,701,628 I336T probably benign Het
Adam19 T A 11: 46,112,875 F177I probably benign Het
Ankrd53 T C 6: 83,768,173 V455A probably damaging Het
Arrdc1 A G 2: 24,925,665 S415P probably benign Het
Atp10a T C 7: 58,797,352 L614P probably benign Het
C130060K24Rik A T 6: 65,456,336 N380I probably benign Het
Catsper1 G T 19: 5,343,963 V668F probably damaging Het
Cluh T A 11: 74,661,918 D596E probably damaging Het
Cnot10 A G 9: 114,615,107 S407P probably benign Het
Commd6 T C 14: 101,634,350 T86A probably damaging Het
D5Ertd579e A T 5: 36,604,657 probably null Het
Eif3l A G 15: 79,085,560 D252G probably damaging Het
Epha2 A T 4: 141,328,468 S962C probably damaging Het
Fcho1 C A 8: 71,714,425 probably null Het
Fgf23 G T 6: 127,073,216 G63C probably damaging Het
Flnc A T 6: 29,445,749 Y834F probably damaging Het
Gcn1l1 T C 5: 115,588,110 L608P probably damaging Het
Hdac5 T A 11: 102,202,276 E545V probably damaging Het
Hecw2 A T 1: 53,937,132 M166K probably benign Het
Ikbkb T C 8: 22,665,893 D586G probably damaging Het
Il1f9 G C 2: 24,188,621 probably null Het
Ipo13 A T 4: 117,904,911 I422N possibly damaging Het
Iqgap3 GGAGAG GGAG 3: 88,112,771 probably null Het
Kat6a G A 8: 22,932,361 A896T probably benign Het
Kif28 A G 1: 179,735,994 I139T probably damaging Het
Klhl25 A G 7: 75,866,342 E332G probably damaging Het
Krt8 C T 15: 101,997,908 A389T probably benign Het
Msrb3 T C 10: 120,784,106 S175G probably benign Het
Muc5ac C T 7: 141,809,744 probably benign Het
Myo10 T C 15: 25,805,659 Y1709H probably benign Het
Nckap5 A G 1: 126,023,194 S1519P probably benign Het
Npnt T A 3: 132,909,910 D124V probably damaging Het
Nr1d1 A T 11: 98,770,836 probably null Het
Ogdh A G 11: 6,340,477 Y365C probably benign Het
Olfr1305 A T 2: 111,872,961 I298N possibly damaging Het
Phf21b A T 15: 84,787,446 C416S probably damaging Het
Prpsap1 A G 11: 116,471,438 S373P probably damaging Het
Rab28 T C 5: 41,703,534 T26A probably damaging Het
Rbbp8nl A G 2: 180,279,226 I455T probably benign Het
Rnft2 G A 5: 118,228,818 A285V possibly damaging Het
Rrp36 G T 17: 46,672,371 Q106K probably benign Het
Rsf1 CG CGACGGCGGAG 7: 97,579,908 probably benign Het
Scn5a A G 9: 119,486,644 L1666P probably damaging Het
Siglecf A C 7: 43,355,200 T318P probably benign Het
Slc22a1 C T 17: 12,667,305 W147* probably null Het
Smchd1 T C 17: 71,353,506 I1868V probably damaging Het
Snx21 A G 2: 164,791,902 S203G probably damaging Het
Srl T C 16: 4,482,831 K792R probably benign Het
Srrt A G 5: 137,298,673 F100S probably benign Het
Stard9 G T 2: 120,697,436 M1391I probably benign Het
Syne2 A G 12: 76,035,630 E119G probably damaging Het
Syt11 G T 3: 88,762,155 S143R possibly damaging Het
Tiparp T A 3: 65,531,642 H126Q probably benign Het
Tulp2 C A 7: 45,518,614 T150K probably benign Het
Ugt2b37 T A 5: 87,242,429 Y386F probably benign Het
Usp31 C T 7: 121,649,640 W860* probably null Het
Zfp317 A G 9: 19,643,665 R30G probably damaging Het
Zfp709 C A 8: 71,889,007 N93K possibly damaging Het
Other mutations in Runx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02020:Runx2 APN 17 44658599 missense probably damaging 1.00
IGL02029:Runx2 APN 17 44658687 nonsense probably null
IGL02084:Runx2 APN 17 44724829 missense probably damaging 1.00
R0040:Runx2 UTSW 17 44608254 missense possibly damaging 0.58
R0627:Runx2 UTSW 17 44658505 intron probably benign
R0944:Runx2 UTSW 17 44608236 missense probably damaging 0.99
R1514:Runx2 UTSW 17 44735337 missense possibly damaging 0.54
R2069:Runx2 UTSW 17 44735342 missense probably benign 0.19
R3976:Runx2 UTSW 17 44610079 missense possibly damaging 0.91
R4686:Runx2 UTSW 17 44639685 missense probably damaging 1.00
R4911:Runx2 UTSW 17 44814192 missense probably damaging 1.00
R5241:Runx2 UTSW 17 44639777 nonsense probably null
R5526:Runx2 UTSW 17 44724862 missense probably damaging 1.00
R6566:Runx2 UTSW 17 44814488 critical splice donor site probably null
R6874:Runx2 UTSW 17 44814192 missense probably damaging 1.00
R6980:Runx2 UTSW 17 44735316 missense possibly damaging 0.65
R7008:Runx2 UTSW 17 44814192 missense probably damaging 1.00
R7009:Runx2 UTSW 17 44814192 missense probably damaging 1.00
R7057:Runx2 UTSW 17 44814537 missense probably null
R7085:Runx2 UTSW 17 44814192 missense probably damaging 1.00
R7175:Runx2 UTSW 17 44814192 missense probably damaging 1.00
R7176:Runx2 UTSW 17 44814192 missense probably damaging 1.00
R7177:Runx2 UTSW 17 44814192 missense probably damaging 1.00
R7181:Runx2 UTSW 17 44814192 missense probably damaging 1.00
R7231:Runx2 UTSW 17 44814192 missense probably damaging 1.00
R7232:Runx2 UTSW 17 44814192 missense probably damaging 1.00
R7254:Runx2 UTSW 17 44814192 missense probably damaging 1.00
R7267:Runx2 UTSW 17 44814192 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTAGTTACACATGCCAAGTGC -3'
(R):5'- CTAACCACAGTCCATGCAGG -3'

Sequencing Primer
(F):5'- GACCTAGGAAAGCTCACA -3'
(R):5'- CCATGCAGGAATAGTAGGTCCTTC -3'
Posted On2018-10-18