Incidental Mutation 'R6877:Stx2'
ID536458
Institutional Source Beutler Lab
Gene Symbol Stx2
Ensembl Gene ENSMUSG00000029428
Gene Namesyntaxin 2
Synonymsrepro34, G1-536-1, Syn-2, Epim
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_007941.2; MGI:108059

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6877 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location128984557-129008574 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 128987820 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 271 (V271A)
Ref Sequence ENSEMBL: ENSMUSP00000031378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031378] [ENSMUST00000100680]
Predicted Effect probably benign
Transcript: ENSMUST00000031378
AA Change: V271A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000031378
Gene: ENSMUSG00000029428
AA Change: V271A

DomainStartEndE-ValueType
SynN 25 146 1.33e-40 SMART
low complexity region 159 170 N/A INTRINSIC
low complexity region 175 185 N/A INTRINSIC
t_SNARE 187 254 1.74e-19 SMART
transmembrane domain 266 288 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100680
SMART Domains Protein: ENSMUSP00000098247
Gene: ENSMUSG00000029428

DomainStartEndE-ValueType
SynN 25 146 1.33e-40 SMART
low complexity region 159 170 N/A INTRINSIC
low complexity region 175 185 N/A INTRINSIC
t_SNARE 187 254 1.74e-19 SMART
transmembrane domain 265 287 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 94% (47/50)
MGI Phenotype Strain: 3526405
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the syntaxin/epimorphin family of proteins. The syntaxins are a large protein family implicated in the targeting and fusion of intracellular transport vesicles. The product of this gene regulates epithelial-mesenchymal interactions and epithelial cell morphogenesis and activation. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display male infertility associated with abnormal testicular development and impaired spermatogenesis, increased intestinal growth due to enhanced crypt cell proliferation and crypt fission, and decreased susceptibility to induced colitis. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted(4) Gene trapped(5) Chemically induced(1)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl2 T C 3: 148,817,286 Y1367C probably damaging Het
Aqr A T 2: 114,116,571 C1043* probably null Het
Arhgef17 A G 7: 100,881,341 S1413P probably damaging Het
AU041133 A G 10: 82,151,571 T352A probably benign Het
Bcl7a A G 5: 123,351,895 T41A probably damaging Het
Btbd10 A T 7: 113,322,760 F298Y probably damaging Het
Ccdc57 G A 11: 120,873,702 T749I probably benign Het
Clcnkb T C 4: 141,404,832 N646S probably benign Het
Dcst1 T C 3: 89,350,360 D701G probably benign Het
Dnah14 C A 1: 181,628,432 T1001K possibly damaging Het
Dnah8 G T 17: 30,746,959 G2422W probably damaging Het
Dyrk2 A T 10: 118,860,423 I310N probably damaging Het
Eif5b A T 1: 38,050,239 N1099Y probably damaging Het
Elp2 T A 18: 24,634,976 N762K probably benign Het
Esco2 A G 14: 65,831,045 V272A probably benign Het
Fat3 A C 9: 15,999,268 S1813A probably benign Het
Gm5346 T C 8: 43,625,237 H650R probably benign Het
Gm5767 G A 16: 8,683,309 V10I unknown Het
Igf2r A G 17: 12,697,341 V1710A probably damaging Het
Iqgap3 GGAGAG GGAG 3: 88,112,771 probably null Het
Kcnk5 T C 14: 20,144,716 T185A possibly damaging Het
Muc5ac C T 7: 141,809,744 probably benign Het
Nol4 A T 18: 22,719,129 C460S probably benign Het
Olfr1307 T C 2: 111,944,839 I206V probably benign Het
Olfr1513 T A 14: 52,349,813 I78F possibly damaging Het
Ovch2 G A 7: 107,790,108 A371V probably benign Het
Pcdhb4 A G 18: 37,309,572 D645G probably damaging Het
Pcnt A C 10: 76,434,017 S207A possibly damaging Het
Pex1 A T 5: 3,635,505 Q1211L probably benign Het
Pnn A G 12: 59,068,767 E99G probably damaging Het
Prkrip1 A T 5: 136,189,624 probably null Het
Rnf133 A G 6: 23,649,487 F191L probably benign Het
Scn10a T C 9: 119,609,782 T1674A probably damaging Het
Sdccag8 G A 1: 177,011,935 V682M probably damaging Het
Spi1 T C 2: 91,114,396 L162P probably damaging Het
Sptan1 C G 2: 30,030,973 N2432K probably damaging Het
Sumf2 G A 5: 129,850,026 D68N probably damaging Het
Tsc22d4 A G 5: 137,762,593 E92G possibly damaging Het
Ube3c G T 5: 29,587,318 R37L probably benign Het
Ubr5 A G 15: 38,002,570 S1446P probably damaging Het
Veph1 T C 3: 66,255,084 N51S probably damaging Het
Vmn1r82 T C 7: 12,305,363 F70L possibly damaging Het
Vmn2r92 A G 17: 18,168,822 N466S probably damaging Het
Vwf T A 6: 125,657,201 V2153D possibly damaging Het
Wdyhv1 C A 15: 58,153,678 P163Q probably damaging Het
Yeats2 A G 16: 20,179,594 T300A probably benign Het
Zc3h12d G T 10: 7,839,971 R46L probably damaging Het
Zfp516 T C 18: 82,955,791 I38T probably damaging Het
Zic5 G A 14: 122,459,688 T505I unknown Het
Zpld1 C T 16: 55,251,671 G75E probably damaging Het
Other mutations in Stx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01729:Stx2 APN 5 128990978 missense probably benign 0.01
IGL01951:Stx2 APN 5 128992265 missense probably damaging 1.00
IGL02348:Stx2 APN 5 128988830 missense probably damaging 1.00
IGL02902:Stx2 APN 5 128992221 missense probably damaging 1.00
R0050:Stx2 UTSW 5 128999508 critical splice donor site probably null
R0050:Stx2 UTSW 5 128999508 critical splice donor site probably null
R0277:Stx2 UTSW 5 128988903 missense probably benign 0.00
R0323:Stx2 UTSW 5 128988903 missense probably benign 0.00
R0419:Stx2 UTSW 5 128993577 splice site probably benign
R0843:Stx2 UTSW 5 128999548 missense probably damaging 1.00
R1346:Stx2 UTSW 5 128988788 unclassified probably benign
R1631:Stx2 UTSW 5 128992225 missense probably damaging 1.00
R1920:Stx2 UTSW 5 128988839 missense probably damaging 1.00
R5350:Stx2 UTSW 5 128991091 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGGGAAACAACACTACTGGC -3'
(R):5'- TTACCGGGTTACATAGCAGGC -3'

Sequencing Primer
(F):5'- ACAACACTACTGGCTGATTGAG -3'
(R):5'- TTACATAGCAGGCTGACTCTAGG -3'
Posted On2018-10-18