Incidental Mutation 'R6877:Btbd10'
ID536467
Institutional Source Beutler Lab
Gene Symbol Btbd10
Ensembl Gene ENSMUSG00000038187
Gene NameBTB (POZ) domain containing 10
SynonymsGmrp1, 1110056N09Rik
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_133700.2; MGI:1916065

Is this an essential gene? Possibly non essential (E-score: 0.473) question?
Stock #R6877 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location113315626-113369392 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 113322760 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 298 (F298Y)
Ref Sequence ENSEMBL: ENSMUSP00000113632 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047091] [ENSMUST00000117577] [ENSMUST00000119278] [ENSMUST00000135510]
Predicted Effect probably damaging
Transcript: ENSMUST00000047091
AA Change: F346Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000048530
Gene: ENSMUSG00000038187
AA Change: F346Y

DomainStartEndE-ValueType
low complexity region 60 75 N/A INTRINSIC
low complexity region 106 147 N/A INTRINSIC
BTB 167 272 1.58e-4 SMART
low complexity region 311 322 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117577
AA Change: F354Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113496
Gene: ENSMUSG00000038187
AA Change: F354Y

DomainStartEndE-ValueType
low complexity region 68 83 N/A INTRINSIC
low complexity region 114 155 N/A INTRINSIC
BTB 175 280 1.58e-4 SMART
low complexity region 319 330 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119278
AA Change: F298Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113632
Gene: ENSMUSG00000038187
AA Change: F298Y

DomainStartEndE-ValueType
low complexity region 12 27 N/A INTRINSIC
low complexity region 58 99 N/A INTRINSIC
BTB 119 224 1.58e-4 SMART
low complexity region 263 274 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135510
SMART Domains Protein: ENSMUSP00000114806
Gene: ENSMUSG00000038187

DomainStartEndE-ValueType
low complexity region 60 75 N/A INTRINSIC
low complexity region 106 147 N/A INTRINSIC
SCOP:d1t1da_ 167 198 3e-6 SMART
Blast:BTB 167 200 1e-15 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 94% (47/50)
Allele List at MGI

All alleles(12) : Targeted(2) Gene trapped(10)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl2 T C 3: 148,817,286 Y1367C probably damaging Het
Aqr A T 2: 114,116,571 C1043* probably null Het
Arhgef17 A G 7: 100,881,341 S1413P probably damaging Het
AU041133 A G 10: 82,151,571 T352A probably benign Het
Bcl7a A G 5: 123,351,895 T41A probably damaging Het
Ccdc57 G A 11: 120,873,702 T749I probably benign Het
Clcnkb T C 4: 141,404,832 N646S probably benign Het
Dcst1 T C 3: 89,350,360 D701G probably benign Het
Dnah14 C A 1: 181,628,432 T1001K possibly damaging Het
Dnah8 G T 17: 30,746,959 G2422W probably damaging Het
Dyrk2 A T 10: 118,860,423 I310N probably damaging Het
Eif5b A T 1: 38,050,239 N1099Y probably damaging Het
Elp2 T A 18: 24,634,976 N762K probably benign Het
Esco2 A G 14: 65,831,045 V272A probably benign Het
Fat3 A C 9: 15,999,268 S1813A probably benign Het
Gm5346 T C 8: 43,625,237 H650R probably benign Het
Gm5767 G A 16: 8,683,309 V10I unknown Het
Igf2r A G 17: 12,697,341 V1710A probably damaging Het
Iqgap3 GGAGAG GGAG 3: 88,112,771 probably null Het
Kcnk5 T C 14: 20,144,716 T185A possibly damaging Het
Muc5ac C T 7: 141,809,744 probably benign Het
Nol4 A T 18: 22,719,129 C460S probably benign Het
Olfr1307 T C 2: 111,944,839 I206V probably benign Het
Olfr1513 T A 14: 52,349,813 I78F possibly damaging Het
Ovch2 G A 7: 107,790,108 A371V probably benign Het
Pcdhb4 A G 18: 37,309,572 D645G probably damaging Het
Pcnt A C 10: 76,434,017 S207A possibly damaging Het
Pex1 A T 5: 3,635,505 Q1211L probably benign Het
Pnn A G 12: 59,068,767 E99G probably damaging Het
Prkrip1 A T 5: 136,189,624 probably null Het
Rnf133 A G 6: 23,649,487 F191L probably benign Het
Scn10a T C 9: 119,609,782 T1674A probably damaging Het
Sdccag8 G A 1: 177,011,935 V682M probably damaging Het
Spi1 T C 2: 91,114,396 L162P probably damaging Het
Sptan1 C G 2: 30,030,973 N2432K probably damaging Het
Stx2 A G 5: 128,987,820 V271A probably benign Het
Sumf2 G A 5: 129,850,026 D68N probably damaging Het
Tsc22d4 A G 5: 137,762,593 E92G possibly damaging Het
Ube3c G T 5: 29,587,318 R37L probably benign Het
Ubr5 A G 15: 38,002,570 S1446P probably damaging Het
Veph1 T C 3: 66,255,084 N51S probably damaging Het
Vmn1r82 T C 7: 12,305,363 F70L possibly damaging Het
Vmn2r92 A G 17: 18,168,822 N466S probably damaging Het
Vwf T A 6: 125,657,201 V2153D possibly damaging Het
Wdyhv1 C A 15: 58,153,678 P163Q probably damaging Het
Yeats2 A G 16: 20,179,594 T300A probably benign Het
Zc3h12d G T 10: 7,839,971 R46L probably damaging Het
Zfp516 T C 18: 82,955,791 I38T probably damaging Het
Zic5 G A 14: 122,459,688 T505I unknown Het
Zpld1 C T 16: 55,251,671 G75E probably damaging Het
Other mutations in Btbd10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01087:Btbd10 APN 7 113316556 missense probably damaging 1.00
IGL03223:Btbd10 APN 7 113332670 missense probably damaging 1.00
I1329:Btbd10 UTSW 7 113332875 missense probably benign 0.00
R0022:Btbd10 UTSW 7 113325781 nonsense probably null
R0022:Btbd10 UTSW 7 113325781 nonsense probably null
R0136:Btbd10 UTSW 7 113329878 missense possibly damaging 0.54
R0299:Btbd10 UTSW 7 113329878 missense possibly damaging 0.54
R0599:Btbd10 UTSW 7 113335309 splice site probably benign
R0657:Btbd10 UTSW 7 113329878 missense possibly damaging 0.54
R1401:Btbd10 UTSW 7 113347059 missense probably benign 0.06
R2916:Btbd10 UTSW 7 113332824 missense probably benign
R3429:Btbd10 UTSW 7 113351809 nonsense probably null
R3430:Btbd10 UTSW 7 113351809 nonsense probably null
R4578:Btbd10 UTSW 7 113322752 missense possibly damaging 0.93
R4626:Btbd10 UTSW 7 113328398 missense probably damaging 0.96
R5067:Btbd10 UTSW 7 113325836 missense probably damaging 0.99
R5480:Btbd10 UTSW 7 113316707 missense probably damaging 1.00
R5667:Btbd10 UTSW 7 113332724 missense probably damaging 1.00
R6468:Btbd10 UTSW 7 113347059 missense probably benign 0.06
R6952:Btbd10 UTSW 7 113351943 splice site probably null
R7059:Btbd10 UTSW 7 113329922 missense probably damaging 0.97
X0027:Btbd10 UTSW 7 113316698 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTAACTGTTTGAGAGGGCTTCC -3'
(R):5'- CCTGTAGATTGGGTTACCTGAC -3'

Sequencing Primer
(F):5'- GGCTTCCCCACACAAATTATTTAAAC -3'
(R):5'- CTGTACTGAATATTGTCCTGTCATG -3'
Posted On2018-10-18