Incidental Mutation 'R6877:Ccdc57'
ID536476
Institutional Source Beutler Lab
Gene Symbol Ccdc57
Ensembl Gene ENSMUSG00000048445
Gene Namecoiled-coil domain containing 57
Synonyms4933434G05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6877 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location120826529-120932872 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 120873702 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 749 (T749I)
Ref Sequence ENSEMBL: ENSMUSP00000050996 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056781]
Predicted Effect probably benign
Transcript: ENSMUST00000056781
AA Change: T749I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000050996
Gene: ENSMUSG00000048445
AA Change: T749I

DomainStartEndE-ValueType
coiled coil region 14 174 N/A INTRINSIC
coiled coil region 198 350 N/A INTRINSIC
low complexity region 356 365 N/A INTRINSIC
coiled coil region 380 489 N/A INTRINSIC
coiled coil region 519 548 N/A INTRINSIC
coiled coil region 575 607 N/A INTRINSIC
low complexity region 620 639 N/A INTRINSIC
internal_repeat_1 657 677 1.17e-5 PROSPERO
low complexity region 763 774 N/A INTRINSIC
low complexity region 787 798 N/A INTRINSIC
internal_repeat_1 863 883 1.17e-5 PROSPERO
low complexity region 915 923 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 94% (47/50)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl2 T C 3: 148,817,286 Y1367C probably damaging Het
Aqr A T 2: 114,116,571 C1043* probably null Het
Arhgef17 A G 7: 100,881,341 S1413P probably damaging Het
AU041133 A G 10: 82,151,571 T352A probably benign Het
Bcl7a A G 5: 123,351,895 T41A probably damaging Het
Btbd10 A T 7: 113,322,760 F298Y probably damaging Het
Clcnkb T C 4: 141,404,832 N646S probably benign Het
Dcst1 T C 3: 89,350,360 D701G probably benign Het
Dnah14 C A 1: 181,628,432 T1001K possibly damaging Het
Dnah8 G T 17: 30,746,959 G2422W probably damaging Het
Dyrk2 A T 10: 118,860,423 I310N probably damaging Het
Eif5b A T 1: 38,050,239 N1099Y probably damaging Het
Elp2 T A 18: 24,634,976 N762K probably benign Het
Esco2 A G 14: 65,831,045 V272A probably benign Het
Fat3 A C 9: 15,999,268 S1813A probably benign Het
Gm5346 T C 8: 43,625,237 H650R probably benign Het
Gm5767 G A 16: 8,683,309 V10I unknown Het
Igf2r A G 17: 12,697,341 V1710A probably damaging Het
Iqgap3 GGAGAG GGAG 3: 88,112,771 probably null Het
Kcnk5 T C 14: 20,144,716 T185A possibly damaging Het
Muc5ac C T 7: 141,809,744 probably benign Het
Nol4 A T 18: 22,719,129 C460S probably benign Het
Olfr1307 T C 2: 111,944,839 I206V probably benign Het
Olfr1513 T A 14: 52,349,813 I78F possibly damaging Het
Ovch2 G A 7: 107,790,108 A371V probably benign Het
Pcdhb4 A G 18: 37,309,572 D645G probably damaging Het
Pcnt A C 10: 76,434,017 S207A possibly damaging Het
Pex1 A T 5: 3,635,505 Q1211L probably benign Het
Pnn A G 12: 59,068,767 E99G probably damaging Het
Prkrip1 A T 5: 136,189,624 probably null Het
Rnf133 A G 6: 23,649,487 F191L probably benign Het
Scn10a T C 9: 119,609,782 T1674A probably damaging Het
Sdccag8 G A 1: 177,011,935 V682M probably damaging Het
Spi1 T C 2: 91,114,396 L162P probably damaging Het
Sptan1 C G 2: 30,030,973 N2432K probably damaging Het
Stx2 A G 5: 128,987,820 V271A probably benign Het
Sumf2 G A 5: 129,850,026 D68N probably damaging Het
Tsc22d4 A G 5: 137,762,593 E92G possibly damaging Het
Ube3c G T 5: 29,587,318 R37L probably benign Het
Ubr5 A G 15: 38,002,570 S1446P probably damaging Het
Veph1 T C 3: 66,255,084 N51S probably damaging Het
Vmn1r82 T C 7: 12,305,363 F70L possibly damaging Het
Vmn2r92 A G 17: 18,168,822 N466S probably damaging Het
Vwf T A 6: 125,657,201 V2153D possibly damaging Het
Wdyhv1 C A 15: 58,153,678 P163Q probably damaging Het
Yeats2 A G 16: 20,179,594 T300A probably benign Het
Zc3h12d G T 10: 7,839,971 R46L probably damaging Het
Zfp516 T C 18: 82,955,791 I38T probably damaging Het
Zic5 G A 14: 122,459,688 T505I unknown Het
Zpld1 C T 16: 55,251,671 G75E probably damaging Het
Other mutations in Ccdc57
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Ccdc57 APN 11 120860469 missense possibly damaging 0.94
IGL01069:Ccdc57 APN 11 120861259 missense probably benign 0.06
IGL02065:Ccdc57 APN 11 120873760 missense possibly damaging 0.85
IGL02143:Ccdc57 APN 11 120861243 nonsense probably null
R0265:Ccdc57 UTSW 11 120921811 missense probably benign 0.00
R1184:Ccdc57 UTSW 11 120873811 splice site probably benign
R1792:Ccdc57 UTSW 11 120897881 missense possibly damaging 0.82
R1834:Ccdc57 UTSW 11 120861219 missense probably benign 0.07
R1852:Ccdc57 UTSW 11 120921673 missense probably damaging 0.98
R1914:Ccdc57 UTSW 11 120903308 splice site probably benign
R2146:Ccdc57 UTSW 11 120885225 splice site probably benign
R2341:Ccdc57 UTSW 11 120860523 missense probably benign 0.00
R3013:Ccdc57 UTSW 11 120861199 missense probably benign 0.01
R4798:Ccdc57 UTSW 11 120881857 missense possibly damaging 0.73
R4821:Ccdc57 UTSW 11 120860399 critical splice donor site probably null
R4869:Ccdc57 UTSW 11 120903518 splice site probably null
R4964:Ccdc57 UTSW 11 120861152 missense probably benign 0.17
R4966:Ccdc57 UTSW 11 120861152 missense probably benign 0.17
R5204:Ccdc57 UTSW 11 120886062 missense possibly damaging 0.73
R5993:Ccdc57 UTSW 11 120894724 missense possibly damaging 0.85
R6072:Ccdc57 UTSW 11 120902075 missense probably damaging 0.98
R6404:Ccdc57 UTSW 11 120894712 missense probably benign 0.10
R7074:Ccdc57 UTSW 11 120903374 missense possibly damaging 0.94
R7102:Ccdc57 UTSW 11 120921731 nonsense probably null
R7311:Ccdc57 UTSW 11 120873741 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGCCAGGAAGCTCTTTTCTTTTGG -3'
(R):5'- AGAATCTCCAGCAGGCCTTC -3'

Sequencing Primer
(F):5'- TGGCAGAACCATGGCAC -3'
(R):5'- CCTTCTGGAGTGTCTTAACAAGGC -3'
Posted On2018-10-18