Incidental Mutation 'R6877:Kcnk5'
ID536478
Institutional Source Beutler Lab
Gene Symbol Kcnk5
Ensembl Gene ENSMUSG00000023243
Gene Namepotassium channel, subfamily K, member 5
SynonymsTASK-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R6877 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location20140057-20181809 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 20144716 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 185 (T185A)
Ref Sequence ENSEMBL: ENSMUSP00000024011 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024011]
Predicted Effect possibly damaging
Transcript: ENSMUST00000024011
AA Change: T185A

PolyPhen 2 Score 0.687 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000024011
Gene: ENSMUSG00000023243
AA Change: T185A

DomainStartEndE-ValueType
Pfam:Ion_trans_2 60 138 7.1e-20 PFAM
Pfam:Ion_trans_2 161 251 2.1e-13 PFAM
low complexity region 257 264 N/A INTRINSIC
low complexity region 317 330 N/A INTRINSIC
low complexity region 469 483 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 94% (47/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the members of the superfamily of potassium channel proteins containing two pore-forming P domains. The message for this gene is mainly expressed in the cortical distal tubules and collecting ducts of the kidney. The protein is highly sensitive to external pH and this, in combination with its expression pattern, suggests it may play an important role in renal potassium transport. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene are smaller than normal and display varying amounts of prenatal lethality depending on genetic background. Otherwise, the mice are viable and fertile. Other targeted mice display aberrations in respiratory physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl2 T C 3: 148,817,286 Y1367C probably damaging Het
Aqr A T 2: 114,116,571 C1043* probably null Het
Arhgef17 A G 7: 100,881,341 S1413P probably damaging Het
AU041133 A G 10: 82,151,571 T352A probably benign Het
Bcl7a A G 5: 123,351,895 T41A probably damaging Het
Btbd10 A T 7: 113,322,760 F298Y probably damaging Het
Ccdc57 G A 11: 120,873,702 T749I probably benign Het
Clcnkb T C 4: 141,404,832 N646S probably benign Het
Dcst1 T C 3: 89,350,360 D701G probably benign Het
Dnah14 C A 1: 181,628,432 T1001K possibly damaging Het
Dnah8 G T 17: 30,746,959 G2422W probably damaging Het
Dyrk2 A T 10: 118,860,423 I310N probably damaging Het
Eif5b A T 1: 38,050,239 N1099Y probably damaging Het
Elp2 T A 18: 24,634,976 N762K probably benign Het
Esco2 A G 14: 65,831,045 V272A probably benign Het
Fat3 A C 9: 15,999,268 S1813A probably benign Het
Gm5346 T C 8: 43,625,237 H650R probably benign Het
Gm5767 G A 16: 8,683,309 V10I unknown Het
Igf2r A G 17: 12,697,341 V1710A probably damaging Het
Iqgap3 GGAGAG GGAG 3: 88,112,771 probably null Het
Muc5ac C T 7: 141,809,744 probably benign Het
Nol4 A T 18: 22,719,129 C460S probably benign Het
Olfr1307 T C 2: 111,944,839 I206V probably benign Het
Olfr1513 T A 14: 52,349,813 I78F possibly damaging Het
Ovch2 G A 7: 107,790,108 A371V probably benign Het
Pcdhb4 A G 18: 37,309,572 D645G probably damaging Het
Pcnt A C 10: 76,434,017 S207A possibly damaging Het
Pex1 A T 5: 3,635,505 Q1211L probably benign Het
Pnn A G 12: 59,068,767 E99G probably damaging Het
Prkrip1 A T 5: 136,189,624 probably null Het
Rnf133 A G 6: 23,649,487 F191L probably benign Het
Scn10a T C 9: 119,609,782 T1674A probably damaging Het
Sdccag8 G A 1: 177,011,935 V682M probably damaging Het
Spi1 T C 2: 91,114,396 L162P probably damaging Het
Sptan1 C G 2: 30,030,973 N2432K probably damaging Het
Stx2 A G 5: 128,987,820 V271A probably benign Het
Sumf2 G A 5: 129,850,026 D68N probably damaging Het
Tsc22d4 A G 5: 137,762,593 E92G possibly damaging Het
Ube3c G T 5: 29,587,318 R37L probably benign Het
Ubr5 A G 15: 38,002,570 S1446P probably damaging Het
Veph1 T C 3: 66,255,084 N51S probably damaging Het
Vmn1r82 T C 7: 12,305,363 F70L possibly damaging Het
Vmn2r92 A G 17: 18,168,822 N466S probably damaging Het
Vwf T A 6: 125,657,201 V2153D possibly damaging Het
Wdyhv1 C A 15: 58,153,678 P163Q probably damaging Het
Yeats2 A G 16: 20,179,594 T300A probably benign Het
Zc3h12d G T 10: 7,839,971 R46L probably damaging Het
Zfp516 T C 18: 82,955,791 I38T probably damaging Het
Zic5 G A 14: 122,459,688 T505I unknown Het
Zpld1 C T 16: 55,251,671 G75E probably damaging Het
Other mutations in Kcnk5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02555:Kcnk5 APN 14 20141985 missense probably benign 0.27
IGL02672:Kcnk5 APN 14 20146512 missense probably damaging 1.00
IGL02716:Kcnk5 APN 14 20181428 missense probably damaging 1.00
IGL03253:Kcnk5 APN 14 20142337 missense probably benign 0.21
R1553:Kcnk5 UTSW 14 20142394 missense probably damaging 1.00
R1693:Kcnk5 UTSW 14 20141896 missense probably damaging 0.99
R1742:Kcnk5 UTSW 14 20141857 missense probably benign 0.00
R2051:Kcnk5 UTSW 14 20142209 missense probably damaging 1.00
R2415:Kcnk5 UTSW 14 20141812 missense possibly damaging 0.61
R4230:Kcnk5 UTSW 14 20144784 missense probably damaging 1.00
R6637:Kcnk5 UTSW 14 20144721 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- GACTAACATCTATCAGGTGCCC -3'
(R):5'- TGAGCCTGGTATGTTCCTAAC -3'

Sequencing Primer
(F):5'- TATCAGGTGCCCAACAAAGGTCTG -3'
(R):5'- GAGCCTGGTATGTTCCTAACCTTAG -3'
Posted On2018-10-18