Incidental Mutation 'R6878:Fancm'
ID536527
Institutional Source Beutler Lab
Gene Symbol Fancm
Ensembl Gene ENSMUSG00000055884
Gene NameFanconi anemia, complementation group M
SynonymsD12Ertd364e, C730036B14Rik
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_178912.3; MGI:2442306

Is this an essential gene? Probably essential (E-score: 0.825) question?
Stock #R6878 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location65075603-65132058 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 65116423 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 1454 (R1454*)
Ref Sequence ENSEMBL: ENSMUSP00000054797 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058889] [ENSMUST00000221838] [ENSMUST00000222540]
Predicted Effect probably null
Transcript: ENSMUST00000058889
AA Change: R1454*
SMART Domains Protein: ENSMUSP00000054797
Gene: ENSMUSG00000055884
AA Change: R1454*

DomainStartEndE-ValueType
DEXDc 75 275 5.6e-25 SMART
Blast:DEXDc 295 323 9e-6 BLAST
low complexity region 339 348 N/A INTRINSIC
HELICc 475 566 5.64e-21 SMART
Pfam:FANCM-MHF_bd 657 770 8.5e-50 PFAM
low complexity region 850 866 N/A INTRINSIC
low complexity region 974 987 N/A INTRINSIC
low complexity region 1105 1120 N/A INTRINSIC
low complexity region 1165 1178 N/A INTRINSIC
PDB:4DAY|C 1207 1238 1e-6 PDB
low complexity region 1489 1506 N/A INTRINSIC
low complexity region 1572 1586 N/A INTRINSIC
low complexity region 1669 1682 N/A INTRINSIC
ERCC4 1780 1863 2.07e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000221838
Predicted Effect probably benign
Transcript: ENSMUST00000222540
Meta Mutation Damage Score 0.658 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency 98% (44/45)
MGI Phenotype Strain: 4355560
Lethality: D500-D600
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group M. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced female transmission, hypogonadism, premature death, and increased incidence of tumors. [provided by MGI curators]
Allele List at MGI

All alleles(39) : Targeted(4) Gene trapped(35)

Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,433,494 N4810K probably benign Het
Arhgap26 A T 18: 39,227,412 I397F probably damaging Het
Arhgap35 A G 7: 16,565,113 V9A probably benign Het
Asl A G 5: 130,024,292 probably null Het
Atg2a T A 19: 6,250,178 L672Q probably damaging Het
B4galt1 T C 4: 40,809,694 D316G probably damaging Het
Bpifb2 A G 2: 153,875,912 probably benign Het
Ccl1 T C 11: 82,179,693 I18V probably benign Het
Cd47 A G 16: 49,910,869 E278G possibly damaging Het
Cilp G A 9: 65,279,847 G1075S probably damaging Het
Eml2 T C 7: 19,200,612 V604A probably benign Het
Gm14124 C T 2: 150,266,486 L56F possibly damaging Het
Gm4302 TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA 10: 100,341,499 probably benign Het
Gm4302 CAG CAGAAG 10: 100,341,507 probably benign Het
Gm4302 GCA GCACCA 10: 100,341,515 probably benign Het
Hif1a T C 12: 73,928,281 M147T possibly damaging Het
Hps5 C G 7: 46,783,634 A221P probably damaging Het
Lrrc49 A G 9: 60,680,148 S67P probably damaging Het
Madd T A 2: 91,169,857 N568I probably damaging Het
Meikin T C 11: 54,411,886 S375P possibly damaging Het
Mfsd6 G T 1: 52,708,753 Q318K probably damaging Het
Mis18a A T 16: 90,721,756 I106N probably damaging Het
Myl2 T C 5: 122,105,077 I148T probably benign Het
Myrf T C 19: 10,216,478 Q730R possibly damaging Het
Nf1 T C 11: 79,434,882 L560P probably damaging Het
Npat A G 9: 53,556,599 T285A probably benign Het
Ntrk3 T A 7: 78,304,372 D547V probably benign Het
Obox2 G T 7: 15,397,320 S117I probably benign Het
Olfr1079 A G 2: 86,538,765 L48P probably damaging Het
Parva T A 7: 112,576,449 N226K possibly damaging Het
Pcdha3 T A 18: 36,947,363 L386* probably null Het
Ppip5k1 A G 2: 121,311,936 F1323S probably benign Het
Prkdc T C 16: 15,777,072 V2771A probably benign Het
Prl7c1 T C 13: 27,778,844 T59A possibly damaging Het
Rab15 T C 12: 76,804,483 T20A probably benign Het
Rp1l1 A G 14: 64,031,852 E1629G probably benign Het
Rpap1 A T 2: 119,778,176 L235Q probably damaging Het
Sema3a A T 5: 13,455,544 I91F possibly damaging Het
Snx6 T C 12: 54,763,601 probably null Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Speer4f2 T G 5: 17,375,767 M114R probably damaging Het
Syne1 T C 10: 5,420,388 D264G possibly damaging Het
Tbl1xr1 T G 3: 22,203,204 N410K possibly damaging Het
Tmed7 A T 18: 46,593,465 D74E probably damaging Het
Upk3b T C 5: 136,039,147 V64A probably benign Het
Vmn2r29 A G 7: 7,241,864 V337A probably benign Het
Yy1 C G 12: 108,814,756 P352A probably damaging Het
Zfp873 T C 10: 82,060,695 I457T probably benign Het
Other mutations in Fancm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Fancm APN 12 65075736 missense possibly damaging 0.50
IGL00489:Fancm APN 12 65106193 missense probably benign 0.01
IGL00529:Fancm APN 12 65130417 utr 3 prime probably benign
IGL00898:Fancm APN 12 65106000 missense probably benign 0.01
IGL01805:Fancm APN 12 65113861 critical splice donor site probably null
IGL01986:Fancm APN 12 65126655 nonsense probably null
IGL02026:Fancm APN 12 65105734 missense probably benign 0.03
IGL02069:Fancm APN 12 65075911 missense probably benign 0.05
IGL02103:Fancm APN 12 65095784 missense probably benign 0.38
IGL02133:Fancm APN 12 65106475 missense probably benign 0.04
IGL02400:Fancm APN 12 65113815 missense probably damaging 1.00
IGL02478:Fancm APN 12 65077090 missense probably damaging 1.00
IGL02479:Fancm APN 12 65106485 missense probably damaging 0.98
IGL02563:Fancm APN 12 65092462 missense probably damaging 1.00
IGL02606:Fancm APN 12 65076139 missense possibly damaging 0.90
IGL02731:Fancm APN 12 65088305 missense probably benign 0.00
IGL02809:Fancm APN 12 65121667 missense possibly damaging 0.54
IGL02953:Fancm APN 12 65121966 missense probably benign 0.27
IGL03066:Fancm APN 12 65125114 nonsense probably null
IGL03073:Fancm APN 12 65101632 missense probably damaging 1.00
PIT4131001:Fancm UTSW 12 65105422 missense probably benign 0.03
R0041:Fancm UTSW 12 65106443 nonsense probably null
R0041:Fancm UTSW 12 65106443 nonsense probably null
R0125:Fancm UTSW 12 65121956 missense possibly damaging 0.68
R0201:Fancm UTSW 12 65101632 missense probably damaging 1.00
R0360:Fancm UTSW 12 65075950 missense probably damaging 1.00
R0491:Fancm UTSW 12 65106061 missense probably benign 0.32
R0557:Fancm UTSW 12 65118442 critical splice donor site probably null
R0617:Fancm UTSW 12 65097317 nonsense probably null
R1201:Fancm UTSW 12 65106768 missense possibly damaging 0.66
R1353:Fancm UTSW 12 65088170 missense probably damaging 1.00
R1456:Fancm UTSW 12 65118351 missense possibly damaging 0.48
R1468:Fancm UTSW 12 65099293 missense probably damaging 1.00
R1468:Fancm UTSW 12 65099293 missense probably damaging 1.00
R1521:Fancm UTSW 12 65121704 missense probably benign 0.25
R1530:Fancm UTSW 12 65092490 critical splice donor site probably null
R1559:Fancm UTSW 12 65093689 missense probably benign 0.00
R1632:Fancm UTSW 12 65130331 missense probably damaging 1.00
R1681:Fancm UTSW 12 65105656 missense probably benign 0.03
R1919:Fancm UTSW 12 65105520 missense possibly damaging 0.48
R1969:Fancm UTSW 12 65101692 missense probably benign 0.09
R1971:Fancm UTSW 12 65101692 missense probably benign 0.09
R2117:Fancm UTSW 12 65077174 missense probably damaging 1.00
R2510:Fancm UTSW 12 65113770 splice site probably benign
R2909:Fancm UTSW 12 65124856 missense probably damaging 1.00
R3155:Fancm UTSW 12 65116421 missense probably benign 0.32
R3405:Fancm UTSW 12 65075772 missense probably benign 0.00
R4133:Fancm UTSW 12 65120530 missense probably benign 0.44
R4308:Fancm UTSW 12 65126531 missense probably benign 0.14
R4588:Fancm UTSW 12 65118441 critical splice donor site probably null
R4602:Fancm UTSW 12 65124944 missense probably benign 0.12
R4653:Fancm UTSW 12 65083054 missense probably damaging 0.99
R4702:Fancm UTSW 12 65122052 missense possibly damaging 0.95
R4719:Fancm UTSW 12 65121706 missense possibly damaging 0.64
R4885:Fancm UTSW 12 65102643 nonsense probably null
R4896:Fancm UTSW 12 65075831 missense probably damaging 1.00
R4908:Fancm UTSW 12 65094871 missense probably benign 0.28
R4921:Fancm UTSW 12 65077141 missense probably benign 0.19
R4922:Fancm UTSW 12 65106892 critical splice donor site probably null
R4948:Fancm UTSW 12 65090974 missense probably damaging 1.00
R5103:Fancm UTSW 12 65105858 missense probably damaging 0.99
R5577:Fancm UTSW 12 65130411 utr 3 prime probably benign
R5631:Fancm UTSW 12 65113843 missense probably damaging 0.97
R5741:Fancm UTSW 12 65101615 missense probably benign 0.01
R6137:Fancm UTSW 12 65130382 missense probably damaging 1.00
R6167:Fancm UTSW 12 65094895 missense probably benign 0.42
R6242:Fancm UTSW 12 65116442 missense probably benign 0.01
R6242:Fancm UTSW 12 65116449 missense probably benign 0.00
R6281:Fancm UTSW 12 65088270 missense probably damaging 1.00
R6325:Fancm UTSW 12 65125052 missense probably damaging 1.00
R6434:Fancm UTSW 12 65077168 missense probably damaging 1.00
R6493:Fancm UTSW 12 65097488 missense probably benign 0.04
R6542:Fancm UTSW 12 65097429 missense probably damaging 1.00
R6645:Fancm UTSW 12 65106100 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTGAACACATACCTGACTGACC -3'
(R):5'- TGTAAAAGTAGTGGGAAAGTGCTTC -3'

Sequencing Primer
(F):5'- ACCAATGGTCTAGCTGGGG -3'
(R):5'- CTAGAGAGATGGCTCAGCACTC -3'
Posted On2018-10-18