Incidental Mutation 'R6879:Agap1'
ID536543
Institutional Source Beutler Lab
Gene Symbol Agap1
Ensembl Gene ENSMUSG00000055013
Gene NameArfGAP with GTPase domain, ankyrin repeat and PH domain 1
SynonymsGgap1, Centg2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.207) question?
Stock #R6879 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location89454806-89897617 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 89766455 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 492 (I492F)
Ref Sequence ENSEMBL: ENSMUSP00000027521 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027521] [ENSMUST00000074945] [ENSMUST00000190096]
Predicted Effect probably benign
Transcript: ENSMUST00000027521
AA Change: I492F

PolyPhen 2 Score 0.246 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000027521
Gene: ENSMUSG00000055013
AA Change: I492F

DomainStartEndE-ValueType
Pfam:Ras 73 231 1.1e-18 PFAM
low complexity region 269 289 N/A INTRINSIC
PH 347 590 1.36e-15 SMART
ArfGap 609 729 4.58e-51 SMART
ANK 768 797 1.83e-3 SMART
ANK 801 832 1.33e2 SMART
low complexity region 840 852 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000074945
SMART Domains Protein: ENSMUSP00000074478
Gene: ENSMUSG00000055013

DomainStartEndE-ValueType
Pfam:Miro 73 181 5e-24 PFAM
Pfam:Ras 73 231 3e-19 PFAM
low complexity region 269 289 N/A INTRINSIC
PH 347 537 7.93e-17 SMART
ArfGap 556 676 4.58e-51 SMART
ANK 715 744 1.83e-3 SMART
ANK 748 779 1.33e2 SMART
low complexity region 787 799 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190096
SMART Domains Protein: ENSMUSP00000140599
Gene: ENSMUSG00000055013

DomainStartEndE-ValueType
Pfam:Miro 73 181 5e-24 PFAM
Pfam:Ras 73 231 3e-19 PFAM
low complexity region 269 289 N/A INTRINSIC
PH 347 537 7.93e-17 SMART
ArfGap 556 676 4.58e-51 SMART
ANK 715 744 1.83e-3 SMART
ANK 748 779 1.33e2 SMART
low complexity region 787 799 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of an ADP-ribosylation factor GTPase-activating protein family involved in membrane trafficking and cytoskeleton dynamics. This gene functions as a direct regulator of the adaptor-related protein complex 3 on endosomes. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adat3 A G 10: 80,606,787 D153G probably damaging Het
Arhgap31 G A 16: 38,602,314 T1130I probably benign Het
Atg2a T A 19: 6,251,852 C923S possibly damaging Het
B3gnt8 C A 7: 25,628,852 Q236K probably benign Het
Bptf T G 11: 107,042,690 I261L probably benign Het
Cacna1s T C 1: 136,115,959 F1592S probably benign Het
Catspere2 A T 1: 178,098,772 T335S possibly damaging Het
Cops7a A T 6: 124,958,785 probably null Het
Defb10 A G 8: 21,861,882 I48V probably benign Het
Gabrg3 A C 7: 57,381,639 L51R probably damaging Het
Gins2 G A 8: 120,586,111 T96M probably damaging Het
Gm11568 A G 11: 99,858,227 Q86R unknown Het
Gm14548 A T 7: 3,896,962 S214T probably benign Het
Il33 T C 19: 29,958,962 V224A probably damaging Het
Kcnh3 C A 15: 99,238,167 Q682K probably damaging Het
Kif19a A G 11: 114,781,333 I249V probably benign Het
Kif26a T C 12: 112,177,653 V1447A probably benign Het
Klhdc10 T A 6: 30,449,590 M217K probably damaging Het
Mcc T C 18: 44,812,112 S18G unknown Het
Mical1 A T 10: 41,484,519 Q651H probably damaging Het
Mpdz G A 4: 81,348,656 T340I possibly damaging Het
Olfr1443 T C 19: 12,680,771 I221T probably benign Het
Olfr771 T G 10: 129,160,979 K2Q probably benign Het
Plekha6 A T 1: 133,260,055 M105L possibly damaging Het
Ppp4r4 T A 12: 103,551,920 probably null Het
Samd12 T C 15: 53,658,430 N128S probably benign Het
Six6 A G 12: 72,940,524 K157E probably benign Het
Slc13a3 C A 2: 165,430,301 G274V probably damaging Het
Slc25a54 T A 3: 109,112,834 V388E possibly damaging Het
Smad2 A G 18: 76,262,654 T55A possibly damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Spats2 T C 15: 99,173,412 V39A probably damaging Het
Stk32b A G 5: 37,490,523 I167T possibly damaging Het
Taf1b T A 12: 24,500,517 C34S possibly damaging Het
Tex2 T C 11: 106,534,010 E812G unknown Het
Tlcd2 T A 11: 75,469,688 W186R probably damaging Het
Txn2 G A 15: 77,919,722 probably benign Het
Uggt2 T C 14: 119,001,859 K1387R probably benign Het
Unc79 T A 12: 103,148,787 probably null Het
Usp21 T C 1: 171,282,503 D538G probably damaging Het
Zfp109 C T 7: 24,229,190 E265K probably benign Het
Zfp263 A G 16: 3,749,855 H390R probably damaging Het
Other mutations in Agap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Agap1 APN 1 89663796 splice site probably benign
IGL00310:Agap1 APN 1 89887670 missense probably damaging 1.00
IGL01104:Agap1 APN 1 89726075 splice site probably benign
IGL02227:Agap1 APN 1 89663775 missense probably damaging 0.99
IGL02959:Agap1 APN 1 89843191 missense possibly damaging 0.94
IGL03303:Agap1 APN 1 89665152 missense probably damaging 1.00
K3955:Agap1 UTSW 1 89887604 missense probably damaging 1.00
R0030:Agap1 UTSW 1 89888744 nonsense probably null
R0234:Agap1 UTSW 1 89671212 missense probably damaging 1.00
R0234:Agap1 UTSW 1 89671212 missense probably damaging 1.00
R0400:Agap1 UTSW 1 89843250 splice site probably benign
R1104:Agap1 UTSW 1 89789240 missense probably damaging 0.99
R1160:Agap1 UTSW 1 89843154 missense probably damaging 0.98
R1439:Agap1 UTSW 1 89843186 missense probably damaging 1.00
R1454:Agap1 UTSW 1 89837806 splice site probably null
R1644:Agap1 UTSW 1 89663730 missense probably damaging 0.97
R1984:Agap1 UTSW 1 89766323 missense probably benign
R2141:Agap1 UTSW 1 89837755 missense probably damaging 0.99
R3966:Agap1 UTSW 1 89834461 missense probably damaging 0.99
R4195:Agap1 UTSW 1 89834539 missense probably damaging 0.99
R4669:Agap1 UTSW 1 89837806 splice site probably null
R4951:Agap1 UTSW 1 89609503 missense probably damaging 1.00
R5525:Agap1 UTSW 1 89743773 missense possibly damaging 0.86
R5843:Agap1 UTSW 1 89609550 missense probably damaging 0.97
R5930:Agap1 UTSW 1 89843096 missense probably damaging 1.00
R6030:Agap1 UTSW 1 89630434 missense probably damaging 1.00
R6030:Agap1 UTSW 1 89630434 missense probably damaging 1.00
R7027:Agap1 UTSW 1 89888722 missense probably benign 0.00
R7207:Agap1 UTSW 1 89843099 missense possibly damaging 0.91
R7268:Agap1 UTSW 1 89766348 missense probably benign 0.02
R7289:Agap1 UTSW 1 89455431 start codon destroyed probably null 0.01
Predicted Primers PCR Primer
(F):5'- TCACCTGACTTGTTTATTCCTAGGG -3'
(R):5'- TTTAAGGTCTACGCCCTGAGC -3'

Sequencing Primer
(F):5'- CTAGGGAATGTCACTAGTGCGTC -3'
(R):5'- TCTACGCCCTGAGCAGAGG -3'
Posted On2018-10-18