Incidental Mutation 'R6880:Rxra'
ID536594
Institutional Source Beutler Lab
Gene Symbol Rxra
Ensembl Gene ENSMUSG00000015846
Gene Nameretinoid X receptor alpha
SynonymsRXRalpha1, RXR alpha 1, 9530071D11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6880 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location27676440-27762957 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 27748656 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 224 (E224K)
Ref Sequence ENSEMBL: ENSMUSP00000133044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077257] [ENSMUST00000100251] [ENSMUST00000113934] [ENSMUST00000166775]
PDB Structure
CRYSTAL STRUCTURE OF A HETERODIMERIC COMPLEX OF RAR AND RXR LIGAND-BINDING DOMAINS [X-RAY DIFFRACTION]
Crystal Structure of the RARbeta/RXRalpha Ligand Binding Domain Heterodimer in Complex with 9-cis Retinoic Acid and a Fragment of the TRAP220 Coactivator [X-RAY DIFFRACTION]
Crystal structure of a mixed agonist-bound RAR-alpha and antagonist-bound RXR-alpha heterodimer ligand binding domains [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000077257
AA Change: E224K

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000076491
Gene: ENSMUSG00000015846
AA Change: E224K

DomainStartEndE-ValueType
Pfam:Nuc_recep-AF1 18 132 4.2e-42 PFAM
ZnF_C4 137 208 1.76e-40 SMART
Blast:HOLI 233 265 1e-8 BLAST
HOLI 275 434 1.62e-53 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000100251
AA Change: E196K

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000097822
Gene: ENSMUSG00000015846
AA Change: E196K

DomainStartEndE-ValueType
Pfam:Nuc_recep-AF1 1 104 1.8e-38 PFAM
ZnF_C4 109 180 1.76e-40 SMART
Blast:HOLI 205 237 1e-8 BLAST
HOLI 247 406 1.62e-53 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000113934
AA Change: E196K

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000109567
Gene: ENSMUSG00000015846
AA Change: E196K

DomainStartEndE-ValueType
Pfam:Nuc_recep-AF1 1 104 1.8e-38 PFAM
ZnF_C4 109 180 1.76e-40 SMART
Blast:HOLI 205 237 1e-8 BLAST
HOLI 247 406 1.62e-53 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000166775
AA Change: E224K

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000133044
Gene: ENSMUSG00000015846
AA Change: E224K

DomainStartEndE-ValueType
Pfam:Nuc_recep-AF1 17 132 6.5e-41 PFAM
ZnF_C4 137 208 1.76e-40 SMART
Blast:HOLI 233 265 1e-8 BLAST
HOLI 275 434 1.62e-53 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 97% (62/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Retinoid X receptors (RXRs) and retinoic acid receptors (RARs) are nuclear receptors that mediate the biological effects of retinoids by their involvement in retinoic acid-mediated gene activation. These receptors function as transcription factors by binding as homodimers or heterodimers to specific sequences in the promoters of target genes. The protein encoded by this gene is a member of the steroid and thyroid hormone receptor superfamily of transcriptional regulators. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Null embryos have multiple organ defects and die of cardiac failure by E14.5. Gene ablation in liver, prostate, fat or epidermis tissue-specifically affects development, function and/or neoplasia. Hypomorphic mutants develop alopecia, progressively severe dermal cysts and late corneal opacity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 T A 3: 36,069,705 probably null Het
Aff3 T C 1: 38,535,162 H206R probably damaging Het
Aff3 T C 1: 38,627,128 D5G possibly damaging Het
Alg5 A G 3: 54,738,843 E43G probably damaging Het
Ankrd36 T C 11: 5,628,748 L4P probably damaging Het
Ano1 T C 7: 144,644,742 Y345C probably benign Het
Atf7ip A G 6: 136,561,040 I432V probably damaging Het
B230307C23Rik T C 16: 97,997,427 probably benign Het
Baz2b T A 2: 59,912,939 N1563Y probably damaging Het
Bhlha15 A T 5: 144,191,633 T188S probably damaging Het
Cbr3 T C 16: 93,690,538 V203A probably benign Het
Cpsf1 T C 15: 76,602,539 T266A probably benign Het
Dnah7c T C 1: 46,527,671 Y681H probably damaging Het
Dock2 C T 11: 34,688,452 probably null Het
Dsc1 T A 18: 20,088,372 D682V probably damaging Het
Fkbp15 A T 4: 62,336,495 I256N possibly damaging Het
Foxd1 A C 13: 98,354,717 D33A unknown Het
Gid4 T A 11: 60,436,435 F149I probably damaging Het
Hmcn2 G T 2: 31,343,056 V206L probably damaging Het
Ighg2b T C 12: 113,307,106 I135V Het
Ighv1-24 T C 12: 114,773,043 Y79C possibly damaging Het
Impg1 T A 9: 80,404,800 D167V probably damaging Het
Jakmip1 T C 5: 37,105,623 S372P possibly damaging Het
Kcnb1 T C 2: 167,105,807 T374A probably damaging Het
Lrrn4 A G 2: 132,872,112 S305P probably damaging Het
Ltbp1 C T 17: 75,321,049 T1179I possibly damaging Het
Mab21l2 A G 3: 86,547,156 I179T possibly damaging Het
Myo5b A T 18: 74,722,430 H1230L probably benign Het
Myocos T C 1: 162,657,033 probably null Het
Nipa2 T C 7: 55,933,251 T249A probably damaging Het
Oas1a C A 5: 120,901,940 R196L probably damaging Het
Olfr228 A G 2: 86,483,725 F6L probably benign Het
Olfr235 A G 19: 12,268,610 I127V probably benign Het
Olfr700 A T 7: 106,805,812 S217T probably damaging Het
Phxr2 G A 10: 99,126,084 probably benign Het
Pigq A G 17: 25,934,828 L85P probably damaging Het
Pla2g4a T A 1: 149,851,451 D518V possibly damaging Het
Pm20d1 A G 1: 131,804,101 K294E probably benign Het
Polr3d C A 14: 70,440,015 R307L probably benign Het
Pou5f2 T C 13: 78,025,494 L185P possibly damaging Het
Prex2 A T 1: 11,132,384 N506Y probably damaging Het
Proser1 T A 3: 53,477,839 S381T probably benign Het
Prpf4b T C 13: 34,894,453 V682A possibly damaging Het
Prr14l A T 5: 32,830,867 L428Q probably benign Het
Prss23 A G 7: 89,510,825 V12A probably benign Het
Qk T C 17: 10,215,447 D321G probably benign Het
Rab11fip5 A G 6: 85,348,845 L193P probably damaging Het
Retreg1 T G 15: 25,971,739 L245R probably damaging Het
Rfc1 T C 5: 65,277,386 N679S probably benign Het
Rpl4 C T 9: 64,177,053 A220V probably damaging Het
Slc26a7 A G 4: 14,516,159 C557R possibly damaging Het
Sncaip A G 18: 52,869,064 K219R probably damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Sphkap A G 1: 83,257,257 V1616A probably damaging Het
Sulf1 T C 1: 12,842,755 C738R probably damaging Het
Suz12 T A 11: 80,002,172 C38* probably null Het
Ttn T C 2: 76,720,498 T23190A probably damaging Het
Twnk A G 19: 45,007,416 D96G probably benign Het
Vcan T A 13: 89,712,381 N289I probably damaging Het
Vmn2r120 A T 17: 57,509,187 S723T probably damaging Het
Vmn2r97 A T 17: 18,914,508 I63F probably benign Het
Washc5 T C 15: 59,350,172 N125S probably benign Het
Zfp865 A G 7: 5,030,549 Y511C probably damaging Het
Other mutations in Rxra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01941:Rxra APN 2 27754241 missense probably damaging 1.00
IGL03006:Rxra APN 2 27759645 missense probably damaging 1.00
pinkie UTSW 2 27752334 missense probably damaging 0.98
R0265:Rxra UTSW 2 27752430 missense probably damaging 1.00
R0578:Rxra UTSW 2 27759570 missense probably damaging 1.00
R1555:Rxra UTSW 2 27748678 missense probably benign 0.00
R1775:Rxra UTSW 2 27756244 missense probably damaging 1.00
R3725:Rxra UTSW 2 27754277 missense probably damaging 1.00
R3756:Rxra UTSW 2 27741911 missense probably damaging 1.00
R3804:Rxra UTSW 2 27756260 missense probably damaging 1.00
R3965:Rxra UTSW 2 27752306 splice site probably benign
R4490:Rxra UTSW 2 27741195 missense probably damaging 0.99
R4898:Rxra UTSW 2 27741183 missense probably damaging 1.00
R5154:Rxra UTSW 2 27757868 critical splice donor site probably null
R5651:Rxra UTSW 2 27737341 missense probably benign 0.25
R6913:Rxra UTSW 2 27741174 missense probably damaging 1.00
R7404:Rxra UTSW 2 27741854 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGTGTGTTCAGGGTATACAGCC -3'
(R):5'- TCTCACTGCTGGGGACAAAG -3'

Sequencing Primer
(F):5'- GTTCAGGGTATACAGCCATCCTG -3'
(R):5'- CAAAGGGCTGGGGGTTC -3'
Posted On2018-10-18